... you have to be able to “sell” your ideas in order to make changes in your favor and, in a win-win situation, provide the other side with a fair deal. This entails a process that can appeal to the intellect ... being manipulated, you can call the other side on their tactics and counter with an appropriate strategy. This will lead to a more effective way of achieving the goals of all negotiating parties. Copyright ... wish to believe it, a great deal of psychological research indicates that human beings are quite predictable in terms of behavior in response to certain stimuli, such as ads. This is why marketing...
Ngày tải lên: 21/12/2013, 04:18
Tài liệu How To Use the Six Laws of Persuasion during a Negotiation docx
... being manipulated, you can call the other side on their tactics and counter with an appropriate strategy. This will lead to a more effective way of achieving the goals of all negotiating parties. Copyright ... This entails a process that can appeal to the intellect using logical and objective criteria, as well as a methodology that positively engages the emotions of the negotiators. The result of a successful ... methods of marketing. Even though you may not wish to believe it, a great deal of psychological research indicates that human beings are quite predictable in terms of behavior in response to certain...
Ngày tải lên: 21/12/2013, 06:18
báo cáo khoa học: " Comparison of hyperthermia and adrenaline to enhance the intratumoral accumulation of cisplatin in a murin model of peritoneal carcinomatosis" potx
... carcinomatosis from ovarian cancer is not well defined. The aim of this study was to assess the ability of hyperthermia and adrenaline to enhance the intratumoral accumulation of cisplatin in a rat ... studies have compared heated with non-heated intraperitoneal cisplatin in ovarian carcinoma. In previous papers, we reported that intraperitoneal adrenaline increased platinum uptake in rat peritoneal tumor ... were treated 21 days after intraperitoneal cell inoculation. Laparotomy was performed in anaesthetized rats (isoflurane inhalation as induction and then 100 mg/kg of intramuscular ketamine and 15...
Ngày tải lên: 10/08/2014, 10:20
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
... AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT pEGFP-N1 ⁄ MEK1 GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG pYESTrp2 ⁄ PDIP46 ⁄ SKAR (A) GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT pYESTrp2 ... GCGGGATCCCACACCATTTTGCTGGTACA ATAAGAATGCGGCCGCCTATTTCCCAGCCTGTTGGGCCTG pGEX-4T1 ⁄ PDIP46 ⁄ SKAR(L7) GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTG pEGFP-N1 ⁄ ER GCGAAGCTTCACGATGTCTCACACCATTT GCGGGATCCCGTTTCCCAGCCTGTTGGGCCT pEGFP-N1 ... GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT pYESTrp2 ⁄ PDIP46 ⁄ SKAR(D) GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG pYESTrp2 ⁄ PDIP46 ⁄ SKAR(E) GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC pYESTrp2...
Ngày tải lên: 19/02/2014, 05:20
Báo cáo khoa học: "Ionizing radiation and inhibition of angiogenesis in a spontaneous mammary carcinoma and in a syngenic heterotopic allograft tumor model: a comparative study." pdf
... treatment response in spontaneous mammary carcinoma and in a syngenic heterotopic allograft tumor model. Tumor growth delay of syngenic mammary carcinoma allografts (A) and orthotopic spontaneous ... 6:66 http://www.ro-journal.com/content/6/1/66 Page 4 of 6 allograft and heterotopic versus orthotopic tumors wit h regard to the treatment response to IoAs and in particu- lar to a combined treatment modality of ... demonstrate that IR in combination with VEGF-receptor tyrosine kinase inhibitors is a valid, promising treatment modality, and that the treatment responses in spontaneous mammary carcinomas and syngenic...
Ngày tải lên: 09/08/2014, 09:20
How to write a biz letter
... your letter if they cannot read your signature! But it also allows you to say how you wish to be addressed: e.g. Mary Caversham (Mrs) or Mrs M.V. Caversham Simon James (Dr) or Dr S. James ... How to write a business letter Please turn over Layout Your company will have its own ideas on how a letter should be laid out, but when writing in English, please remember to start ... wishes ã Ways of starting a letter: We are writing to enquire about … I am writing in connection with … We are interested in … and we would like to know ã Ways of referring to a letter...
Ngày tải lên: 08/05/2014, 20:02
How To Write A Business Plan One in a series of online training courses doc
... between a company’s assets and liabilities). The balance sheet provides a measure of a business’s value at a particular point in time. It is considered a snapshot in time. Click here to view an automated ... understanding of your customers and their needs. The ability to satisfy your customers' needs better than your competitors are able to can help you build customer loyalty and increase sales. However, ... Management Components of the Business Plan Section 3: The Details OK……So now you know what financial statements are and how important they are. Financial statements are an integral component of the business plan....
Ngày tải lên: 28/06/2014, 18:20
How to Write a Marketing Plan
... Much of this information can be handled within a graphical format, such as tables and graphs, though a paragraph explanation of each is generally required. Make sure to include total dollar (or ... business plan, such as a new business proposal to the financial community. There are many ways to develop and format a marketing plan . The approach taken here is to present a 6-Part plan that includes: ... Other Areas Preferably this section includes a brief summary of current marketing decisions (see Situational Analysis) so readers of the plan can easily compare what was planned to what is planned....
Ngày tải lên: 08/08/2012, 15:18
How to Write a PhD Thesis
... than the appearance. In many cases, a reasonably neat diagram can be drawn by hand faster than with a graphics package, and you can scan it if you want an electronic version. Either is usually ... want to wax lyrical about your topic, here is the place to do it. Try to make the reader want to read the kilogram of A4 that has arrived uninvited on his/her desk. Go to the library and read ... information and arguments as a series of numbered points, rather than as one or more long and awkward paragraphs. A list of points is usually easier to write. You should be careful not to use...
Ngày tải lên: 10/09/2012, 15:25
How to Write a Corporate Image Brochure People Will Truly Want to Read
... self-delusory approach to corporate image brochures are plain to see: high costs and low value. But it doesn't have to be this way. Some years ago, I was commissioned to write a corporate image ... for a pharmaceutical company. When it was printed, not only did people read it, they actually called the company to request additional copies to give to friends, clients, and professional colleagues. ... can assume that "everyone will want to read what I am going to write& quot;. This is the "creative writing attitude". The purpose of expository writing is usually to inform and...
Ngày tải lên: 18/10/2012, 14:47
Layout of a formal letter
... organising it in a clear and logical manner rather than expanding too much. Last Paragraph The last paragraph of a formal letter should state what action you expect the recipient to take- to ... Content of a Formal Letter First paragraph The first paragraph should be short and state the purpose of the letter- to make an enquiry, complain, request something, etc. The paragraph or paragraphs ... example: Dear Sir or Madam, Closure of bank account no. 56777889 I would like to inform you …… Layout of a Formal Letter The example letter below shows you a general layout for a formal letter. Pass...
Ngày tải lên: 01/08/2013, 05:42
How to write a five paragraph essay
... three supporting paragraphs that follow. PREPARED BY SANDRA DANIEL How To Write An Effective Five Paragraph Essay PREPARED BY SANDRA DANIEL Topic: The death penalty should be abolished. Do ... comparison. Body Paragraphs – part 2 PREPARED BY SANDRA DANIEL Thesis Statement – part 1 An effective thesis statement should make a strong assumption about the topic and serve as a map for the rest of the ... move to a broader focus. Introduction - start with a narrow focus and end your conclusion with a broad statement about the topic. An effective five paragraph essay shows not only a writer’s ability...
Ngày tải lên: 19/08/2013, 14:15