how old are you c 5 6

... Numbers 16- 20 - How old are you? / And you? to talk about age 17,19 C 5, 6 - Further practice in Numbers 0-20 to count and How old are P you? (and give telephone numbers) 17-19 III/ Vocabular Lesson ... ? How old are you ? - Lan trả lời nh ? Im eleven + T reads the dialogue, Ss repeat c Model : A : This is ( Lan ) B : Hello, ( Lan ) How old are you ? C : I m eleven (years old) Concept check ... name? Lucky Lumber How are you? Where you live? How you speel your schools name? Whats your name? Lucky Number Lucky Number 10 Where you live? Consolidation - Ask Ss to say out again the main content...

Ngày tải lên: 20/10/2014, 21:00

... between A and C A B C * between and : Ss are asked to read the new words after the teacher Then they practice reading chorally and individually Free practice : Ss are asked to look at the pictures ... answer : Trang VI Homework : Ss are asked to : learn new words by heart Write four sentences about your house Prepare new lesson : Unit 06 c3 / c4 / c5 / c6 new words answer the questions ... are to the right of the house 6. Where is the house ? It is between the well and the flowers c Free practice : Ss are asked to look at the pictures and answer the questions : 1.Where is the chicken...

Ngày tải lên: 13/10/2013, 21:11

Ngày tải lên: 01/11/2013, 12:20

... a cold last week and now you' re feeling ill What must have happened? a) You passed on the cold b) You picked up the cold c) You got over the cold Henri stopped going t o school before he was old ... back, onto, across Page 13 Surfing the web Page Picture Connections 1A + 4B = 6C seahorse; 2A + 8B = 4C fish fingers; 3A + 3B = snowman; 4A + 1B = ladybird, C C C 5A + 6B = jacket potato; 6A ... wears off When you complete a form, what you do? a) You fill it up b) You fill it in c) You take it in Which sentence is correct? a) A caterpillar turns over a butterfly b) A caterpillar turns...

Ngày tải lên: 01/11/2013, 16:20

... including serious food poisoning Remedy: Control is seldom easy because it is difficult to get the insecticide to the insect The insecticide should have sufficient persistence to kill baby cockroaches ... with an insecticide This can be dangerous as the wasps can become angry and attack any animal (including humans) in the area and is best performed by professionals Some local councils will it ... that you can get at the joists Cover electric cables and the cold water storage tank Lift floorboards to get at the undersides and joists You can have detailed surveys, reports and estimates carried...

Ngày tải lên: 15/12/2013, 11:15

... opportunity you are given to practice, practice, and practice some more If you wait until you can say something perfectly, you will never speak Spanish Take chances! You will not only learn to communicate ... Apartment Building En un edificio de apartamentos 43 Contents In the Kitchen En la cocina vii 45 Electrical Appliances in the Kitchen Los aparatos eléctricos en la cocina 45 Containers and Utensils ... weather, soap operas, etc.), and listen to them repeatedly You can also record your speech and then listen to yourself as a way to check your pronunciation Practice In conclusion, the only way...

Ngày tải lên: 04/05/2014, 12:54

... biết quân c c ch xếp quân bàn c Y /c : H c sinh nhận biết đ c quân c biết c ch xếp quân c bàn c - H c cách di chuyển c ch ăn quân bàn c Y /c : nắm đ c cách di chuyển ăn quân quân c II- Địa ... M c tiêu - Ôn số động t c thể d c RLTTCB h c Y /c : th c động t c x c tr c - H c động t c đứng đa chân sau, hai tay giơ cao thẳng hớng Y /c : Th c động t c - Ôn trò chơi Chuyển bóng tiếp s c Y /c ... Ôn số động t c thể d c RLTTCB h c Y /c : th c động t c x c tr c - H c đứng kiễng gót hai tay chống hông Y /c : Th c động t c - Chơi trò chơi : Diệt vật c hại Y /c: Chơi nhiệt tình, chủ động II-...

Ngày tải lên: 15/06/2013, 01:26

... NR (2008) Solution structure of a double mutant of the carboxy-terminal 3310 53 54 55 56 57 58 59 60 61 62 63 64 65 dimerization domain of the HIV-1 capsid protein Biochemistry 47, 2289–2297 ... (20 05) Heat capacity in proteins Annu Rev Phys Chem 56 , 52 1 54 8 Spolar RS & Record MT (1994) Coupling of local folding to site-speci c binding of proteins to DNA Science 263 , 777–784 Pace CN & Scholtz ... Gln48, Lys 55, Thr 56, Ile57, Leu58, Ala60, Gly62, Leu67, Met71, Gly78 FEBS Journal 2 75 (2008) 3299–3311 ª 2008 The Authors Journal compilation ª 2008 FEBS 3307 Dynamics of monomeric CAC L A Alcaraz...

Ngày tải lên: 07/03/2014, 06:20

... AATGGAGGAGTGACGG-3¢), Hi_pDEDR (5 -CG GGATCCCGTTAATAAAAGCCTGTTGCTGGTT-3¢), Hi_Nterm F (5 -ACGCGTCGACGTCATGACTGCTGCT CTGGCCGT-3¢), and Hi_Nterm R (5 -CGGGATCCCGC TGCTGGTATCGCTCCTTTG-3¢), and cloned in pPROTET ... humidified conditions (P8), and AAAGACATA (P9), and their complementary sequences CATGTCTCT (P 2C) , CATGTCCTT (P 3C) , CATGTATTT (P 4C) , CATGGCTTT (P 5C) , CATCTCTTT (P 6C) , CAGGTCTTT (P 7C) , CGTGTCTTT (P 8C) , ... introduced using speci c primers (forward, 5 -CCTGATGCAGGCTA CAGTTCT-3¢; and reverse, 5 -GCATATGCATGTATT TATTTTTCTTC-3¢) and standard procedures The speci c mutation (G to T) was confirmed by sequencing...

Ngày tải lên: 07/03/2014, 10:20

... AGG GCT GCG GGT G-3¢; HCV-1b Core+1/S sense, 5 -ATC CGG GGT CTC CCATG GCA ATG AGG GCC TGG GGT G-3¢; HCV-1a Core+1/S antisense, 5 -AT CCG GGT CTC GGTACC TTA TCA CGC CGT C TT CCA GAA C- 3¢; and HCV-1b ... provided by C Brechot) [69 ] and the following primers: sense, 5 -CAT GCC ATG GCA CCA ACC GCC GCC CAC A-3¢; and antisense, 5 -CCC AAG CTT GGG GGG CGC CGA CAA GC-3¢ (underlined sequences indicate NcoI ... and HCV-1b Core+1/S antisense, 5 -AT CCG GGT CTC GGTACC CTA GGG GGG CGCC G A CG-3¢ (italic indicates BsaI sites; underlined sequences correspond to NcoI sites for sense primers, and Acc65I sites...

Ngày tải lên: 15/03/2014, 09:20

... bookboon.com C# Introduction to programming and the C# language Contents Arrays 62 Two arrays of the type int 62 Array of strings 64 Yatzy 64 Craps 66 Part Object Oriented Programming 70 Classes 73 Coins ... Please click the advert “The perfect start of a successful, international career.” CLICK HERE to discover why both socially and academically the University of Groningen is one of the best places ... 20 Generic types 158 Generic methods 158 Sorting an array 160 Parameterized types 164 he class Set 166 21 Exception handling 174 22 Comments 181 23 Extension methods 187 Part Collection classes...

Ngày tải lên: 18/03/2014, 02:20

... (antisense) C5 4 (antisense) GTGCTTGCGAATTCCCCGGGA CTCGAATTCAGTTGACGCCGTCTTCCAGAACC CGTAGACCGTGCACCAGCACGAATCCTAAAC GTTTAGGATTCGTGCTGGTGCACGGTCTACG CCTAAACCTCAAAAAAAAACAAACGTAACACC GGTGTTACGTTTGTTTTTTTTTGAGGTTTAGG ... GGTGTTACGTTTGTTTTTTTTTGAGGTTTAGG CCGGAATTCCGCCACCATGGCAATGAGGGCTGCGGGTGGGCGGG GGAATTCCAGCGGTTTAAACTCAATG CTCGAATTCAGTTCACGCCGTCTTCCAG CTCGAATTCCACTAGGTAGGCCGAAG PCR amplification of the myc-tagged HCV-1 core ⁄ core+1 sequence ... Deletion of core nts 342 51 4 ATG core+1 85 with optimal context GCCCCTCTATGG fi CCGCCACCATGG ATG core+1 85 with optimal context GCCCCTCTATGG fi CCGCCACCATGG myc Deletion of adenine (A) at core codons...

Ngày tải lên: 30/03/2014, 03:20

... at positions 60 2 ⁄ 60 3, 62 7 ⁄ 62 8 and 65 9 ⁄ 66 0 As shown in Fig 5, mPC1 ⁄ is not able to cleave the Fig The CT-peptide is cleaved by hfurin but not by mPC1 ⁄ The RP-HPLC purified CT-peptide was ... fluorometric assays using a fluorogenic substrate [ 45] Cloning, expression and purification of recombinant mPC1 ⁄ CT-peptide The cDNA encoding the murine PC1 ⁄ CT-peptide from positions 59 2–7 26 was cloned ... sequences Curr Med Chem 11, 2 65 1 – 26 65 Taylor NA, Van De Ven WJ & Creemers JW (2003) Curbing activation: proprotein convertases in homeostasis and pathology FASEB J 17, 12 15 1227 Fricker LD, McKinzie...

Ngày tải lên: 30/03/2014, 08:20

... GATCGAATTCTCAGCCGGCTGGCCAGCA, GATCGAATTCCTCACCCCACACCGGCCTAC, GATCGAATTCCCTACGCTACACCTCCG, GATCGAATTCTGGCCGCCGCAGGC, GATCGTCGACTCATGCAGGCATCTGGCTGTAATTG GATCGTCGACTCAGCTGCGCTCGGACATCTGAAGGC GATCGTCGACTCATATTCGGGACAGCGTGGCTG ... GATCGAATTCCCTGAGAGACTGGAAGGCAAAG GATCGGATCCACTTTGCCTTCCAGTCTCTCAG GATCGAATTCTTTGTCTGTGACCCAGATGC GATCGGATCCTTAGAGGGCATCTGGGTCACAG GATCGGATCCACTCCGCCACTCAGAAACTTAG GATCGAATTCTCACCCACCCATCAGAATC GATCGAATTCCCCCTGCAGATGCCAAAGATG ... GATCGAATTCTGGCCGAGAGCCACCAGCAC, GATCGAATTCTGGCGGGGAACAAGCCG, GATCGAATTCTGCACAAGGTTCTGAACCA, GATCGAATTCTGAGCGACATGAAGGCGGAC, GATCGAATTCTAGCGGACGTGACCCGCCTG, GATCGAATTCCCATCGCAGCCCGCCTTCAGATG, GATCGAATTCTCAGCCGGCTGGCCAGCA,...

Ngày tải lên: 30/03/2014, 09:20

... ± 0 .6 6. 3 4.9 ± 0.2 1.3 ± 0.1 1.8 ± 0 .6 0.7 ± 0.2 2 .6 ± 0.7 6. 8 f 6. 0 ± 0.4 6. 3 5. 1 3.0 ± 0.3 4 .5 ± 0.9 2 .5 ± 0 .6 4 .5 ± 1.0 6. 8 6. 4 6. 3 5. 1 37 C 37 C 36 C 38 C 6. 4 ± 0.3 2 .6 ± 0 .6 4.0 ... 0 .6 ± 0.1 ≤0 .5 ± 0.0 26. 4 ± 1 .5 21.0 ± 1.7 10 .5 ± 0.9 14.8 ± 1.9 16. 9 ± 0.7 12.9 ± 1.0 8 .6 ± 1.8 5. 9 ± 0 .5 6. 3 ± 0 .5 12.2 ± 1 .6 11.7 ± 2 .5 14.3 ± 1.1 5. 1 ± 0.8 8.4 ± 1.2 5. 1 ± 0 .6 3.2 ± 0 .6 2 .6 ... provides two chances to achieve an optimal balance between safety and efficacy Conclusion The rHPIV1-CR84G/Δ170HNT 553 ALY942A and rHPIV1-CR84G/ Δ170HNT 553 ALΔ1710–11 vaccine candidates are highly...

Ngày tải lên: 18/06/2014, 18:20

... ± 0 .6 6. 3 4.9 ± 0.2 1.3 ± 0.1 1.8 ± 0 .6 0.7 ± 0.2 2 .6 ± 0.7 6. 8 f 6. 0 ± 0.4 6. 3 5. 1 3.0 ± 0.3 4 .5 ± 0.9 2 .5 ± 0 .6 4 .5 ± 1.0 6. 8 6. 4 6. 3 5. 1 37 C 37 C 36 C 38 C 6. 4 ± 0.3 2 .6 ± 0 .6 4.0 ... 0 .6 ± 0.1 ≤0 .5 ± 0.0 26. 4 ± 1 .5 21.0 ± 1.7 10 .5 ± 0.9 14.8 ± 1.9 16. 9 ± 0.7 12.9 ± 1.0 8 .6 ± 1.8 5. 9 ± 0 .5 6. 3 ± 0 .5 12.2 ± 1 .6 11.7 ± 2 .5 14.3 ± 1.1 5. 1 ± 0.8 8.4 ± 1.2 5. 1 ± 0 .6 3.2 ± 0 .6 2 .6 ... provides two chances to achieve an optimal balance between safety and efficacy Conclusion The rHPIV1-CR84G/Δ170HNT 553 ALY942A and rHPIV1-CR84G/ Δ170HNT 553 ALΔ1710–11 vaccine candidates are highly...

Ngày tải lên: 20/06/2014, 01:20

... to the cows, and cars are careful not to hit the cows There are special animal hospitals for old or sick cows The government and some rich people pay for these hospitals People in other countries ... soft A machine cannot work on soft ground, but a cow can work Cows also not cost a lot of money They don't need gasoline or repairs like machines Farmers care about their cows very much They want ... year, there are special celebrations for the cows These celebrations are like Thanksgiving in the United States Old cows cannot work on farms In India, it is against the law to kill a cow So farmers...

Ngày tải lên: 17/07/2014, 18:49

Ngày tải lên: 28/07/2014, 08:20

... Yesterday Cocoa and Objective -C are at the heart of Apple’s Mac OS X operating system Although Mac OS X is relatively new, Objective -C and Cocoa are much older Brad Cox invented Objective -C in the ... applications that have a true Mac OS X look and feel This book teaches you the Objective -C language and introduces you to its companion, Apple’s Cocoa toolkit Cocoa is written in Objective -C and contains ... programming ■ Chapter 4, “Inheritance,” describes how to create classes that gain the features of their parent classes ■ Chapter 5, “Composition,” discusses techniques for combining objects so they can...

Ngày tải lên: 12/08/2014, 20:22