high yield strength results in a l

... (Years) All patients AVNRT AVRT EAT From symptom to ablation (Years) All patients AVNRT AVRT EAT RF-Applications (Number) All patients AVNRT AVRT EAT Examination time (Minutes) All patients AVNRT AVRT ... EAT patients Panel A: Quantity and duration of episodes and the associated symptoms Panel B: Detraction in daily life generally and in parts of daily life variable PANAL A Detraction in daily ... cryoablation of supraventricular tachycardia (atrial fibrillation, atrial flutter, Wolff-Parkinson-White syndrome, atrioventricular nodal reentry tachycardia) Journal of cardiovascular electrophysiology...

Ngày tải lên: 03/11/2012, 11:44

... Demographic characteristic of the sample population is given in table The place has a tropical climate and is made of alluvial soil in the Gangetic plain The population is stable and usually consumes ... Health in India He is both an otolaryngologist and an epidemiologist Dr Basu graduated in the year 1990 from Medical College, Calcutta, India and had further graduate training in otolaryngology ... Table and the proportionate national data had been given simultaneously Our population showed slightly older than the national data Total family screened was 526 (average adult persons per family...

Ngày tải lên: 02/11/2012, 11:12

... to an extended maltodextrin metabolism External maltose and maltodextrins appear to be metabolized by a complex pathway that includes the action of amylomaltase (malQ), maltodextrin phosphorylase ... 14 C-labeled ADPglucose [23] Endoamylase activity was estimated by SDS/PAGE following renaturation [24] Autoglycosylation assay Following purification the recombinant Glg2p was dialyzed against ... glycogenin is unlikely to be limited by the cellular levels of UDPglucose In E coli, UDPglucose plays a central role in various pathways, such as the galactose or trehalose metabolism, and also in the...

Ngày tải lên: 19/02/2014, 16:20

... declining on day after the adult emergence, and remaining low during the vitellogenic phase [8] In the ant S invicta, VgR mRNA levels are higher in virgin alate females than in fully vitellogenic ... of ootheca transport Ovarian BgVgR mRNA levels appeared high at the beginning of the last nymphal instar, steadily declining along the instar, and reaching the lowest values of the instar before ... These included the insects D melanogaster (AAB60217), A gambiae (EAA06264), A aegypti (AAK15810), S invicta (AAP92450) and P americana (BAC02725), and the vertebrates Anguila japonica (BAB64337),...

Ngày tải lên: 16/03/2014, 14:20

... subtidal volume deliveries until an oscillatory plateau is reached and maintained [5] At the end of inspiration, the lung is allowed to empty passively until a preset expiratory base-line is reached ... paper PZ, VS and BP analyzed the data and helped to write the paper CS analysed the data All authors read and approved the final manuscript Competing interests The authors declare that they have ... cardiogenic mixing - mechanical agitation from the normal heart beat, especially in peripheral lung units; and (6) molecular diffusion - the mixing of air in the smallest lung units near the alveolo-capillary...

Ngày tải lên: 11/08/2014, 02:21

... of the inferolateral and anterolateral walls with a small area of reversibility Taking his advanced age into account, we decided against performing cardiac catheterization He subsequently underwent ... with advanced HF All patients had critically low BP measured by cuff, and 18 had an unmeasurable BP and pulse They all had cold and mottled skin and increased central venous pressure Eleven patients ... had rales in the lungs, three had pulmonary edema, and one had anasarca The doses of NTG used in each patient, as well as the times of infusions, are listed in Table BP became obtainable or increased...

Ngày tải lên: 11/08/2014, 14:20

... 5’CCTGACTCCAAGACTGTTGGTGATTCCACCAAGATTTGAGGGCTTCC3’, LL814AAFP - 5’GC TGTTAACGCGGCCAATGCCAATGCCACAGC3’, LL814AARP - 5’GGCATTGGCCGCGT TAACAGCACTATTC3’, LL855AAFP - 5’GGGCTTGGAAAGGATTGCGGCATAAGATGGG3’, ... motifs also overlap with the amphipathic a- helical lentiviral lytic peptides LLP1 (aa 828-856) [42,43], LLP2 (aa 770-795) [44], and LLP3 (aa 789-815) [45] This feature complicates mutational analyses ... since the results of BLAM assays closely paralleled the infectivity results observed, in that only A, Y, and YA exhibited any virus-cell fusion and only at a level of approximately 20% that of WT...

Ngày tải lên: 13/08/2014, 01:20

... p65/RelA ΔNH2p65 Nucleus Figure Subcellular localization of a p65/RelA amino-truncated form in activated human T cells Subcellular localization of a p65/RelA amino-truncated form in activated human ... DNA-binding domain in the amino-terminus of p65/RelA by cleavage at a sequence near a caspase-3 cleavage site, leaving a carboxy-terminal fragment that contains two potent transactivation domains ... p65/RelA in activated Jurkat cells Subcellular localization of tagged p65/RelA and endogenous p65/RelA in activated Jurkat cells (a) Jurkat cells did not show cleavage of p65/RelA in the cytosol...

Ngày tải lên: 13/08/2014, 05:21

... company HISALBA (Spain) sold its Holderchem Euco concrete chemical business, Holnam (USA) sold its Seattle plant, including raw material reserves, and Alpha Limited (South Africa) hived off Alpha ... 363 362 14 377 363 Uncalled capital (5) Capital paid -in Uncalled capital 0 Capital surplus 1,559 1,436 Capital paid -in 365 80 43 Capital surplus 1,924 1,559 Retained earnings 3,583 3,261 Profit ... currency, in domestic sales with a further in- Brazil was spared spiraling inflation crease in cement and clinker exports thanks to an astute monetary policy By contrast, La Cemento Nacional in The International...

Ngày tải lên: 27/07/2014, 16:05

... (Vif/Vpr) DNA Cellular viral RNA Virion RNA HIV-YRHHY >A5 (Vif/Vpr) DNA Cellular viral RNA Virion RNA HIV-YRHHY >A5 (DIS/Gag) DNA Cellular viral RNA Virion RNA a The GA (%) GC (%) GT (%) Total (25%) ... used to amplify the N-terminal region of Vif The C-terminal portion of Vif was amplified using the forward primer YRHHYmutF, 5'GGAAAGCTAAGGACTGGT TTGCTGCAGCTGCCGCTGAAAGTACTAATCCAAAAATA AG3', and ... hypermutation was highest in viral DNA, reduced in cellular viral RNA (cRNA), and lowest in virion RNA (vRNA), indicating a gradient of hypermutation We surmise that purifying selection at multiple...

Ngày tải lên: 13/08/2014, 05:21

... using chisquare and Kruskal Wallis tests to determine significance levels Kruskal-Wallis tests and multivariable linear regression models were applied to study the association between the abovementioned ... regression model P-values < 0.05 were considered statistically significant for all analyses All statistical analysis was performed with SAS, version 9.13 Results Table shows gender-specific characteristics ... Little RA: Salbutamol, a beta 2-adrenoceptor agonist, increases skeletal muscle strength in young men Clin Sci (Lond) 1992, 83(5):615-621 23 Angulo M, Taranto E, Soto JP, Malacrida L, Nin N, Hurtado...

Ngày tải lên: 25/10/2012, 10:45

... Chicago, IL, USA) RESULTS Survival of animals Vital signs including blood pleasure, pulse, respiration, and blood oxygen saturation of all animals were stable during and after HIFU, demonstrating the ... collected and leukocyte numbers, and levels of blood amylase, glucose, aspartate aminotransferase (AST), urea nitrogen (BUN) and total bilirubin were determined by Automatic Biochemical Analyzer ... until blood and urine amylase levels reached a normal level when these pig intravenously received penicillin (4.8×106 units), gentamycin (1.6×105 units), and ranitidine (100g) in 5% glucose saline...

Ngày tải lên: 25/10/2012, 11:18

... case reports of successful IVF in women with renal transplants, but specialists were becoming increasingly reluctant to advise women with transplants against trying for a baby, as medical care ... during pregnancy, remaining remarkably stable The pregnancy was complicated at 20 weeks’ gestation by a right deep vein thrombosis, affecting the femoral and external iliac veins, and anti-coagulation ... neonate Severe pre-eclampsia and eclampsia can result in irreversible damage to the maternal kidney, particularly due to acute renal cortical necrosis Women who have recurrent pre-eclampsia in...

Ngày tải lên: 01/11/2013, 08:20

... expired, and banned drugs are available in the marketplace For example, caregivers can still purchase a sachet of loperamide that is advertised for infants, but was outlawed from the international market ... public sector RACHA, a health organization working on child survival, had an established village 10 www.casesjournal.org ARC/CRC was implementing an integrated child health project that used a ... Intensive lobbying by health organizations, NGOs, Maternal and Child Health Technical Working Groups and continuous advocacy for this cause are warranted Public health officials should also be encouraged...

Ngày tải lên: 12/02/2014, 19:20

Ngày tải lên: 15/02/2014, 13:20

... glutamine the accumulated label gradually increased till 48 h At day 15 of differentiation (Fig 1B, squares) the absolute level of labelled glutamine in the cells again remained higher when administered ... intracellular and extracellular lectin, which interacts with intracellular glycoproteins, cell surface proteins and extracellular matrix proteins Overexpression of galectin-3 in human breast carcinoma ... basolateral glutamine uptake in Caco-2 monolayers Apical (open symbols) and basolateral (closed symbols) uptake was measured after exposing cells to medium containing 2.0 mM glutamine, trace-labelled...

Ngày tải lên: 20/02/2014, 01:20

... resulting strain carried the deletion of the chromosomal atp2 operon and several copies of a plasmid carrying the mutated atp2 operon As a control, a parallel atp2-deleted strain was created, in ... photoeterotrophically on a synthetic medium containing malate as a carbon source [30]; kanamycin and tetracycline were added at 25 and lgÆmL)1, respectively Cultures were illuminated by two opposite panels each ... data reported in Fig 1B were obtained In this case, the ATP yield of both wild-type and mutant as a function of illumination time presented a lag phase before becoming linear A similar lag phase...

Ngày tải lên: 21/02/2014, 03:20

... patients, the cellobiose-mannitol ratio was elevated at baseline, mainly as a result of increased cellobiose absorption, reflecting increased intestinal paracellular permeability This parameter improved ... in genetically predisposed individuals A defect in mucosal barrier function could allow luminal bacterial antigens to initiate a chronic relapsing inflammation Several studies have shown an increased ... PCDAI is a multi-item index including subjective reporting of abdominal pain, general well-being, and diarrhea and physical findings, including linear growth and laboratory parameters (hematocrit,...

Ngày tải lên: 05/03/2014, 12:20

... available to date on the PL protein-mediated organization of chromatin, and what little information is available has come mainly from invertebrate organisms [20,27] In this sense, the red mullet ... H1-like protein in the sperm of Mytilus J Biol Chem 268, 195–199 Supplementary material The following supplementary material is available online: Table S1 Proteins used in the phylogenetic analysis ... The Authors Journal compilation ª 2006 FEBS 4553 Protamine-like proteins and chromatin N Saperas et al strong resemblance to that obtained in a similar fashion in the blue mussel Mytilus edulis...

Ngày tải lên: 08/03/2014, 08:20

... spells Difficulty Remembering Fainting Gastrointestinal Digestive Problems Cardiovascular Breathing Difficulty Musculoskeletal Back Pain Tooth Pain Facial Injuries Infections Cold, Flu, Other Infections ... (Quantitative) Joelle Mak Data Entry Johna Hoey Data Entry, Policy Analysis Kathleen Weneden Data Analysis (Qualitative) Charlotte Watts Co-Principal Investigator Scotland Gary Christie Helen Baillot ... Scotland Belgium Scotland Belgium Scotland Belgium Scotland Belgium Scotland Belgium Scotland Belgium Scotland Belgium Scotland Belgium Scotland Belgium Scotland Belgium Scotland Belgium Any...

Ngày tải lên: 14/03/2014, 12:20