hgf c met signaling pathway involved in regeneration and growth

... TCCAGGAGCTGTCTCTCCAT GAGCATCCAAGGTCACAATG AAGCCACCTCCAATGTCATC TGACGAAGGTCCTCAGGG GGGATACGCACAGACACCTT AGGGGCGTCTGAAGTTCC GACCCCCAGGACCAGAGT TTCCTCCAGGGACAGAAGAA AGAGCAATCCCAGGGTCC GAGTTTGGGCAGGTGGTG ... AGGGTTTGGGGTTGTGGT CCCAGATTCCACAGACACCT GTGAACAGGCCCAACCTG GTTGTCCTGGATGACGGC ATGGAGGGCAGCAGAAGAG TGGGAGGGTGATTGAGGA TGGTGCGGTTTGGTAGGT ATCCAGTTGAGGTCGTGAGC CATACAAAGCTGGTGGCTCA GenBank accession number ... Primer sequence* Amplicon size (nucleotides) Forward ERα ERβ Vtg Zr-protein Vigilin AhRα AhRβ AhRR Arnt CYP1A1 UDPGT Proteasome GATCTCAGCCATACCCTCCA CACTTTGTCATGCCCACTTC GGGAGTCTGTCCCAAGACAA AGGGTTTGGGGTTGTGGT...

Ngày tải lên: 13/08/2014, 13:20

... obtained by fluorescence microscope (Leica, Italy) http://www.translational-medicine.com/content/7/1/40 Q-Banding Cells in log phase were cultured with 50 μL of colchicine for hours and mitotic cells ... which finally influence their cell cycle inducing an S phase shifting and the TGFβ secretion Table 1: Morphometrical characteristics of cultured fibroblasts Parameter Feret Diameter (μm) Perimeter ... insulinlike growth factor receptor, 5-HT receptor-associated proteins, nuclear fibroblast growth factor receptor-1 and cytokine receptors) [5,20-22] Researches about the involvement of FBs in CD are actually...

Ngày tải lên: 18/06/2014, 15:20

... activated charcoal flocculated satisfactorily (the flocculation values at pH 2.5 of kaolin clay and activated charcoal were 79.6% and 67.1%, respectively) On the other hand, in the basic region flocculation ... determined using the molybdenum-H2SO4 method (Schinttger et al., 1959) Protein was determined according to the method of Lowry et al (1951) using a standard of bovine serum albumin Nucleic acid and ... Flocculating activities of the extracellular polymer are summarized in Table The polymer showed flocculating activity for kaolin clay and activated charcoal suspension, and stimulated reflocculation...

Ngày tải lên: 05/09/2013, 09:08

... pulcintFW1 (5¢-CCT GTG CTT CGA GAT CCA AC-3¢), pulcintFW2 (5¢-GCA TCT ACC TAC CTT TTC AC-3¢), pulcintRW1 (5¢-CAC CCA TCG TTG GCT AGC CC-3¢) and pulcintRW2 (5¢-GTA AAG TGC CCA TTG CTG CTC-3¢) Each ... toxic type RIP named pulchellin It exhibits specificity for galactose and galactose-containing structures, can agglutinate human and rabbit erythrocytes, and kills mice and the microcrustacean ... fetal bovine serum containing graded concentrations of pulchellin isoforms Subsequently, cells were washed twice with NaCl ⁄ Pi and incubated in NaCl ⁄ Pi containing 10 lCiÆmL)1 [35S] methionine for...

Ngày tải lên: 18/02/2014, 16:20

... sites However, we cannot exclude binding of the aromatic substrate to a buried cavity in case such an interaction would not cause changes in the protein fluorescence signal An interaction between ... in 70% acetonitrile/water solution Thirty pmol were mixed with 50 lL sinapinic acid matrix and were injected into the mass spectrometer The kinetic constants for the two artificial electron acceptors ... degradation Microbios 88, 213–221 Pessione, E & Giunta, C (1997) Acinetobacter radioresistens metabolizing aromatic compounds II Biochemical and microbiological characterization of strain Microbios...

Ngày tải lên: 21/02/2014, 00:20

... NapC_Rsph CymA_Sput NrfH_Ddes NrfH_Sdel NrfH_Wsuc Cytc_Dgig Cytc_Ddes 110 L ECRNCHNF E L ECRNCHSAE L ECRNCHAAV L ECRNCHSEV ANCQHCHT RI ANCKACHT QT CI S CHQS L CI SCHASL CHNI L CHANT ... boiled Protein content was determined with the Bicinchoninic Acid Protein Assay Kit (Pierce), using horse heart cytochrome c as standard (Sigma) The relative molecular mass of the ccNiR complex as ... Luna-Chavez, C. , Croal, L.R., Cecchini, G & Rees, D .C (2002) Crystallographic studies of the Escherichia coli quinol-fumarate reductase with inhibitors bound to the quinolbinding site J Biol Chem...

Ngày tải lên: 21/02/2014, 00:20

... 22.8 (C- 3 and C- 5), 27.5 (C- 7), 28.8 (C- 9 and C- 10), 31.5 (C- 2 and C- 6), 32.9 (C- 4), 69.7 (C- 1) and 73.5 (C- 8) The NMR data above were in agreement with those of 1,8-cineole [30] Concluding remarks ... mL and total number of cells is 3136 in which cell length is 15 mm and the distance to the cell center is 82.5 mm Descending and ascending modes can be interconverted by a four-way switching ... discussions The selection of the two-phase solvent system is the first and critical step for an HPCPC or an HSCCC separation Successful separation by HSCCC or HPCPC depends on the suitable selection...

Ngày tải lên: 07/03/2014, 21:20

... (94 C for min, 64 C for min, and 72 C for min) In addition to the above degenerated reverse primer two direct primers 5¢-AACCATGGCCTCCCACGCCGAGA AGCC(G /C) CTG-3¢ and 5¢-AACCATGGCCAGCCAC 274 ... a clone containing the complete Ch-Prx1 gene Two heterologous primers, (5¢-GACTTCACCTTCGTGTGCC CCACCGAG-3¢ and 5¢-GGGGTCGATGATGAACAG GCCGCG-3¢), designed from the conserved 5¢ and 3¢ sequences ... 5¢-GCGGATCCTTA(G /C) ACGGCGGCGAAGTAC TCC-3¢ After reverse transcription for 30 at 42 C, the ®rst-strand cDNA was ampli®ed in a PCR performed under the following conditions: at 96 C; 39 cycles...

Ngày tải lên: 08/03/2014, 16:20

... for cloning into a vector containing the sequence encoding the GFP: primer 238 (5¢-CCATGGGA GGACGAAGCTTGACA-3¢) extended by an NcoI restriction site and primer 239 (5¢-AGATCTGAACATTTTCCC AACACC-3¢) ... (5¢-CGGATCCAGAGGACGAAGCTTGACA-3¢) extended by a BamHI restriction site and primer 103 (5¢CTGCAGGAACATTTTCCCAACACC-3¢) extended by a PstI restriction site Primer 308 (5¢-GGATCCTCTGCAA CATCCGTA-3¢) ... determined that the phytotoxic peptide malformin, produced by Aspergillus niger, has the essential structure of a cyclic pentapeptide containing d-cysteine: cyclo-d-cysteinyl d-cysteinyl l-amino acid...

Ngày tải lên: 16/03/2014, 18:20

... CACGTTATCTGCGGCCGCTTTCACGGTTAATGCGGTGCC CACGTTATCTGCGGCCGCTTTCACGGTTAATACGGTGCCAGCTCC GGTTAATACGGTGCCAGCTCCCYYMNNMNNMNNMNNMNNRYHRYH RYHRYHMNNMNNMNNMNNMNNMNNTGCTCCACACTTATACGTGCCACTG TTTCACGGTTAATACGGTGCCAGCTCCTTTCTCMNNMNNMNNMNNRYHR ... Library construction 6980 (‹) CDR3 Library construction 7210 (‹) (fi) (fi) (fi) (‹) (‹) (‹) 7211 (‹) GTCTCGCGGCCCAGCCGGCCATGGCCGCAAGGGTGGACCAAACACC GTCTCGCGGCCCAGCCGGCCATGGCCGCATGGGTAGACCAAACACC CACGTTATCTGCGGCCGCTTTCACGGTTAATGCGGTGCC ... 5¢-TTTCACGGTTAA TGCGGTGCCAGCTCCCCAACTGTAATAAATACC AGACAAATTATATGCTCCaacCCTATACGTGCCA CTG-3¢); followed by secondary PCR using VNAR terminal oligonucleotide primers [17] to complete the framework and incorporate...

Ngày tải lên: 17/03/2014, 10:20

... re-testing and validating the effects on cell growth by transforming W303. 1C and plating the cells at 23 C, 30 C and 37 C A cold-sensitive growth phenotype (where toxin is active and interferes ... Site-directed mutagenesis of ricin A-chain and implications for the mechanism of action Proteins 10, 270–278 33 Otwinowski Z & Minor W (1997) Processing of X-ray diffraction data collected in oscillation ... endoplasmic reticulum retrieval sequence to ricin A chain significantly increases its cytotoxicity to mammalian cells J Biol Chem 268, 23986–23990 Simpson JC, Dascher C, Roberts LM, Lord JM & Balch WE...

Ngày tải lên: 23/03/2014, 07:20

... domain Hence, MUC15/S may represent a secreted nongel forming mucin-type molecule as it does not contain any cysteine-rich regions characteristic for the gel forming mucins [1] Examination of a corresponding ... gland Likewise, the deduced amino-acid sequences of both bovine and human MUC15 resemble the mucins in having serine, threonine and proline as the predominant amino acids, however, their high contents ... in the mucinlike glycoproteins mouse MUC14, endomucin-1, and endomucin-2 [26] Nevertheless, the extracellular region of MUC15 and traditional mucin tandem repeat domains share the same characteristics...

Ngày tải lên: 24/03/2014, 04:21

... nls sekr gnrly copih y hnig i hsedad cetain paes eeal acmls b cagn p c pe，n acnuto t S m eape icue h praie en ， n y， u，s o mgt o e xmls nld t evsv n， a a d obt a y u ih e epc，hs snec edns i e b ... i asi Tgr bsbl cp a d er t sek i a a v k te Gnat n! abte a ITOUTO NRDCIN ・ 1 W a IKni h ts ik? T eKnirgo f aa ，aldKniC i o近畿地 in aaee h ik eino Jpn cle ik h h Jpns， cvr a ie ein n h suhr hl o ... e caatr r m h a eo ec i.KiHnSi loicue h hrce f o ten m f ahcy e-a-hnas nldste t srubn i e i bten sc a Iaai Hrkt，n Nsioia ubra c i n ewe，uh s brg，iaaaa d ihnmy ts T a emtese e o ecnuig tevrino...

Ngày tải lên: 27/03/2014, 12:26

... 5¢-AATGTC TTTCTCTCCATGG-3¢, 60 C, 29 cycles; XHIVEP3, 5¢-GCAGCACTATCCCTGCTAAG-3¢ and 5¢-TCCCTC GTCCACGGCCTCTTACAT-3¢, 60 C, 29 cycles Further oligonucleotides: Histone H4, 5¢-CGGGATAACATTCA GGGTATCACT-3¢ ... GGGTATCACT-3¢ and 5¢-ATCCATGGCGGTAACTG TCTTCCT-3¢, 60 C, 22 cycles; Xbra, 5¢-GGATCGTTAT CACCTCTG-3¢ and 5¢-GTGTAGTCTGTAGCAGCA-3¢, 60 C, 28 cycles; Gsc, 5¢-ACAACTGGAAGCACT GGA-3¢ and 5¢-TCTTATTCCAGAGGAACC-3¢, ... 5¢-TCTTATTCCAGAGGAACC-3¢, 60 C, 28 cycles; XWnt8, 5¢-TGTGGCCGGGTCTGAACTTA TTTT-3¢ and 5¢-GTCATCTCCGGTGGCCTCTGTTCT-3¢, 60 C, 28 cycles Microinjection of Xenopus oocytes and analysis of nuclear transport [35S]Methionine...

Ngày tải lên: 30/03/2014, 13:20

... Cataloging -in- Publication Data Sanders, Clinton Customizing the body : the art and culture of tattooing / Clinton R Sanders with D Angus Vail.—Rev and expanded ed p cm Includes bibliographical references and index ... aspects of an increasingly popular form of body decoration” and Choice labeled it a “fascinating and wellwritten study.” Reviews directed at sociological or academic audiences (such as in Contemporary ... channels Within this structural context the collective action is coordinated through the use of "conventions"-shared understandings that specify the commonly accepted and expected form and content...

Ngày tải lên: 11/06/2014, 15:14

... L-glutamine, penicillin and gentamicin Methods for obtaining and passaging human foreskin fibroblast (HFF) cells were described previously [13] All cell lines were maintained at 37 C in the presence ... penicillin, 50 μg/ ml streptomycin and non-essential amino acids Vero Cells were obtained from ATCC and were maintained in MEM with Earl's salts and the addition of 10% FBS and standard concentrations ... Sidwell RW: Characterization and treatment of cidofovir-resistant vaccinia (WR strain) virus infections in cell culture and in mice Antivir Chem Chemother 2005, 16:203-211 Kern ER, Hartline C, Harden...

Ngày tải lên: 20/06/2014, 01:20

... digoxigeninlabeled probe using a commercial reagent (ECL, Amersham, Piccataway, NJ) have been described [35] Two digoxigenin-labeled probes, ggcttttaaagcgctacagtgatgt and ggtcacaaaacgggagtggggagctcc, were used ... times and clarification at 8500 g for 30 min, was inoculated into MA104 cells and plaque purified three times Two distinct plaques distinguished on size were obtained and further passed in MA104 cells ... Polymerase chain reaction amplification and typing of rotavirus nucleic acid from stool specimens J Clin Microbiol 1990, 28:276-282 Laird AR, Gentsch JR, Nakagomi T, Nakagomi O, Glass RI: Characterization...

Ngày tải lên: 20/06/2014, 01:20

... CCATGACAACGGACAGCAGTT CCTGTCAACTGAGCAGCACTTTG GTGGCGAATACTGGCGAGACT CCCCATTCTTTTTCACCGTCG ACGATGTGGTTTATTCTGGA CTTCACGTGACCATACATAT GCGCTGTCGAGTTCTATCGAGC CAACGGTGACTTTATCGCCATTCC CCGCAGCCAA GCGATCCCCA ... Antimicrobial discs Kanamycin Levofloxacin Nalidixic acid Norfloxacin Ofloxacin Polymyxin B Sparfloxacin Streptomycin Tetracycline Tobramycin Trimethoprim/ sulfamethoxazole Resistant (%) Intermediate ... DWK, Lincome LL, Jacewicz MS, Keusch GT Shiga toxin interaction with intestinal epithelial cells Escherichia coli O157:H7 and Shiga toxin-producing E coli strains American Society for Microbiology,...

Ngày tải lên: 07/08/2014, 18:21

... succocotcaL pb 0011 pb 003 eaini succocotpertS pb 817 sirebuarap succocotpertS negohtaP noiger tegraT GTTGGGCGCTCCCACG GLp CGCTAAGAGTAACAATAC GLp TCATATCGCTATATACTTCG 0782 apS GTTGTAACGGAGTCTGCTTT ... :ssikym suhcnyhrocnO ,tuort wobniar ni snoitcefni eaini succocotpertS dna eaeivrag succocotcaL C onittihG ,A radlE 31 248-048 ,54 ,5991 loiretcaB tsyS J tnI eaini succocotpertS fo mynonys roinuj a ... esaesid fo esuac a ,eaeivrag succocotcaL YS uhC dna JY gneW ,CC iaL ,LJ eeL ,DY niL ,YS gnehC ,RG niL ,HT nehC ,CY nehC ,LK gnaY ,HY iasT ,CH gnahC ,YC uW ,CS oK ,YH uS ,LL waiL ,CS nehC 142-532 ,91...

Ngày tải lên: 07/08/2014, 18:21

... (sense, 5´-TCCGCCAGA AACAATACCTC-3´; antisense, 5´-AAGGGTAGGACGCTCCGTAT-3´), collagen 1A1 (COL1A1) (sense, 5´-CACCTCAGGAGAAGGCTC AC-3´; antisense, 5´-ATGTTCTCGATCTGCTGGCT-3´), osteonectin (SPARC) (sense, ... 5´-GTGGTGCAAC CTTCGTGTC; antisense, 5´-GCTCGCATACTTCCCTCTT G-3´) Canine glyceraldehyde-3-phosphate dehydrogenase primers (sense, 5´-AACATCATCCCTGCTTCCAC-3´; antisense, 5´-TCCTTGGAGGCCATGTAGAC-3´) were ... Cell culture & cell growth kinetics and CPDL We isolated cUCB-MSCs from canine umbilical cord blood following to the cell isolation & culture method The cUCB-MSCs (1 × 10 ) were collected and...

Ngày tải lên: 07/08/2014, 23:22