... K.S Chang et al / Sensors and Actuators B 138 (2009) 148–153 149 with HF solution After defining the contact pad patterns, a stack of Ti (10 nm) and Au (100 nm) was then evaporated with a thermal ... The structures of 1,5-EDANS, mA51 moiety and mA51-mA51 a film of SiO2 (thickness 30 nm) and surface modification at varied stages, such as a treatment with APTES and also with BS3 and protein as ... phosphate buffer (10 mL, 20 mM, pH 7.5) After desalting, the sample solution (10 mL) was loaded onto a HiTrap Q column (30 mL, Pharmacia) for chromatographic separation The column was eluted with...
Ngày tải lên: 16/03/2014, 15:23
... 5' AGGGAAACCTTCGTTCCTCAT 3' 5' TCAATCATGGACCGCGCCGTT 3' 5' CGCAGAAGATAGGTGATACAA 3' 5' ACATTCAGGACACAATATGGG 3' 5' CACAGGCTGCTGTTGGGTAT 3' 5' ACAAGAGTCAATCATGGACCG 3' 5' TCGTCTTCCCAACCATCCTAT ... Mori H, Tawara H, Nakazawa H, Sumida M, Matsubara F, Aoyama S, Iritani Y, Hayashi Y, Kamogawa K Expression of the Newcastle disease virus (NDV) fusion glycoprotein and vaccination against NDV challenge ... fusion and hemagglutininNeuraminidase antigens Avian Dis 1996, 40, 770-777 Iritani Y, Aoyama S, Takigami S, Hayashi Y, Ogawa R, Yanagida N, Saeki S, Kamogawa K Antibody response to Newcastle disease...
Ngày tải lên: 07/08/2014, 20:24
báo cáo khoa học: " The changing trends in tobacco smoking for young Arab women; narghile, an old habit with a liberal attitude" ppt
... 12(6):606-612 Dar-Odeh NS, Bakri FG, Al-Omiri MK, Al-Mashni HM, Eimar HA, Khraisat AS, Abu-Hammad SM, Dudeen AA, Abdallah MN, Alkilani SM, Al-Shami L, AbuHammad OA: Narghile (water pipe) smoking among ... Rahman S, Almutawa A ASB, Al-Bedah AM, Al-Rabeah AM, Ali Bahaj A, El-Awa F, CW JN, Asma S: Prevalence of tobacco use among students aged 13-15 years in Health Ministers’ Council/Gulf Cooperation ... communicable diseases To that end, it is of prime importance that research is established to investigate whether the “hygienic hoses” and the disposable “mabsams” are as hygienic as they are thought to...
Ngày tải lên: 11/08/2014, 18:20
Báo cáo y học: "Two-year Outcome of Turkish Patients Treated with Zotarolimus Versus Paclitaxel Eluting Stents in an Unselected Population with Coronary Artery Disease in the Real World: A Prospective Non-randomized Registry in Southern Turk
... Abbreviations ACC: American College of Cardiology; AHA: American Heart Association; CABG: coronary artery binding graft; CK: creatine kinase; MACE: major adverse cardiac events; MI: myocardial ... indicate that the ZES is safe and reduces the rates of clinical and angiographic restenosis in patients with symptomatic coronary artery disease (CAD; 4) Also the safety and efficacy of Paclitaxel-eluting ... in the baseline clinical or demographic characteristics between patients receive ZES versus PES Baseline angiographic characteristics were similar according to the modified ACC/AHA (American College...
Ngày tải lên: 25/10/2012, 11:18
Báo cáo y học: "Efficacy of Sirolimus-Eluting Stents Compared With Paclitaxel-Eluting Stents in an Unselected Population With Coronary Artery Disease: 24-Month Outcomes of Patients in a Prospective Non-randomized Registry in Southern Turkey&
... 2010, chronic total occlusion,5 and acute myocardial infarction.6 Although several head-to-head analyses of the SES and the PES have been published in the medical literature, uncertainty remains ... During the procedure, a bolus dose of unfractionated heparin (100 U/kg) was injected through a femoral or radial artery sheath, with a bolus repeated as needed to maintain an activated clotting time ... P value < 0.05 was considered statistically significant RESULTS Baseline clinical, angiographic, and lesion characteristics are shown in Tables and The baseline clinical or demographic characteristics...
Ngày tải lên: 26/10/2012, 08:57
Báo cáo y học: " Autosomal dominant polycystic kidney disease with diffuse proliferative glomerulonephritis - an unusual association: a case report and review of the literature" pptx
... glomerulonephritis associated with autosomal dominant polycystic kidney disease Nephron 1993, 65(2):316-317 12 Nakahama H, Inoue T, Kakihara M, Takama T, Mikami H, Orita Y, Kamada T: A case of polycystic ... mother also had the disease A general physical examination revealed his blood pressure was 170/110 mmHg and he had bilateral pitting pedal edema A systemic examination of our patient was unremarkable ... FJ: Acute renal failure in a patient with adult polycystic kidney disease JAMA 1981, 245:1664-1665 17 Hariharan S, Date A, Jacob CK: Adult polycystic kidney disease with diabetic intercapillary...
Ngày tải lên: 11/08/2014, 12:20
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
... IgG, Santa Cruz Biotech, CA) The assay was developed using a stabilized HRP substrate All samples were analyzed in the linear range of the ELISA using over-expressed human Vgf as a standard Assessment ... prevents the early phase of diet-induced obesity Proc Natl Acad Sci USA 2006; 103(39): 14584-14589 Yamaguchi H, Sasaki K, Satomi Y, Shimbara T, Kageyama H, Mondal MS, Toshinai K, Date Y, Gonzalez ... cyclooxygenase-2 inhibitors in a transgenic mouse model of amyotrophic lateral sclerosis FASEB J 2003; 17(6): 725-727 Zhao Z, Lange DJ, Voustianiouk A, Macgrogan D, Ho L, Suh J, Humala N, Thiyagarajan...
Ngày tải lên: 03/11/2012, 10:52
Báo cáo khoa học: Unconventional translation initiation of human trypsinogen 4 at a CUG codon with an N-terminal leucine A possible means to regulate gene expression pdf
... were raised separately against recombinant human trypsin (mAb B1, mAb B7) and the 28-amino acid leader peptide (mAb p28) Although all of these antibodies react with the leader peptide containing ... may have used a CUG start codon with an N-terminal leucine amino acid Our present study indicates that nonAUG translation initiation may be operable more often than anticipated This may have a ... the supernatants were used for immunoafnity chromatography Immunoafnity chromatography Supernatant fractions of human brain and transfected HeLa cell homogenates were passed through the 1.5 0.5...
Ngày tải lên: 07/03/2014, 10:20
Báo cáo Y học: Solution structure of the Alzheimer amyloid b-peptide (1–42) in an apolar microenvironment Similarity with a virus fusion domain potx
... of a fluorinated alcohol, hexafluoroisopropanol (HFIP) HFIP has been chosen as a result of a vast exploratory search because it can dissolve Ab-(1–42) better than all other media and, at the same ... fact, although HFIP is a polar molecule, it can solvate apolar surfaces with its strongly hydrophobic side chains; this feature has been aptly described by Rajan et al as a Teflon coating that ... Several organic solvents and mixtures of organic solvents with water, such as trifluoroethanol, trifluoroethanol /H2 O, hexafluoroacetone hydrate, hexafluoroacetone hydrate /H2 O, HFIP /H2 O, CH3OH, dimethylsulfoxide,...
Ngày tải lên: 08/03/2014, 09:20
The Report of the Task Force on Financial Mechanisms for ICT for Development - A review of trends and an analysis of gaps and promising practices ppt
... villages through 4700 kiosks across six states (Madhya Pradesh, Karnataka, Andhra Pradesh, Uttar Pradesh, Maharashtra and Rajasthan) Source: Excerpted from http://itcportal.com/ Smaller and micro ... Iceland, Korea, Poland, Slovak Republic and Turkey), Arab countries (Kuwait, Saudi Arabia and United Arab Emirates) and other donors (Israel and others) China and India also provide aid, but the ... stake at the time) In fact, after privatization, Telmex became the single largest company in the Mexican stock exchange, which meant that Telmex’s share volatility was a major determinant of the...
Ngày tải lên: 15/03/2014, 19:20
Báo cáo khoa học: The chloroplast ClpP complex in Chlamydomonas reinhardtii contains an unusual high molecular mass subunit with a large apical domain doc
... eukaryotic ClpP2 within Proteobacteria rather than Cyanobacteria This suggests that it was inherited, together with the upstream clpX gene, from the ancestral mitochondrial, rather than plastidial, endosymbiont ... pseudonana (Tp, a Diatom) The Viridiplantae (green, of a lighter shade for chloroplast genes) are Arabidopsis thaliana (At), Chlamydomonas reinhardtii (Cr), Chlorella vulgaris (Cv), Nicotiana tabaccum ... indicates Cyanophora paradoxa (Cp, a Glaucocystophyte) and red Cyanidioschyzon merolae (Cm, a Rhodophyte) The brown color indicates Guillardia theta (Gt, a Cryptophyte) and Thalassiosira pseudonana (Tp,...
Ngày tải lên: 16/03/2014, 23:20
Báo cáo khoa học: Solution structure of an M-1 conotoxin with a novel disulfide linkage pdf
... an M-1 conotoxin W. -H Du et al zation of a novel conus peptide with apparent antinociceptive activity J Biol Chem 275, 32391–32397 18 Sharpe IA, Gehrmann J, Loughnan ML, Thomas L, Adams DA, Atkins ... sequence and disulfide bonding pattern of a novel conotoxin BtIIIB Acta Chimica Sinica 63, 163–168 Han YH, Wang Q, Jiang H, Liu L, Xiao C, Yuan DD, Shao XX, Dai QY, Cheng JS & Chi CW (2006) Characterization ... was supported by the National Basic Research Program of China (2004CB719900) and the National Natural Science Foundation of China (20473013) We thank CD Poulter (Department of Chemistry, Southern...
Ngày tải lên: 30/03/2014, 09:20
an oh maser flare with a strong magnetic field in w75n
... This Zeeman pair was probably overlooked by the authors, or dismissed as showing too large a velocity separation d From EVN data are really new as they are related to the flare which took place ... close to VLA2, at a distance of 55 mas (±40 mas), or at the projected distance of 110 AU (±80 AU) Therefore, the OH masers may well be located in the same shell as the water masers The magnetic ... water masers associated with star-forming regions is typically around 100 mG, which is about the same order of magnitude as in the OH maser flare reported here The appearance of new strong maser...
Ngày tải lên: 28/04/2014, 13:15
phosphorene an unexplored 2d semiconductor with a high hole mobility
... epitaxial mismatch with a substrate, will change phosphorene from a direct-gap to an indirect-gap semiconductor with a significantly smaller gap Details of the computational approach are listed in the ... interface We also observe good current saturation at high drain bias values, with the highest drain current of 194 mA/mm at 1.0 μm channel length at the back gate voltage Vbg = À30 V and drain ... the mobility (ii) In a particular transistor, the current flow may not match the direction, where the material has the highest in-plane mobility (iii) The Schottky barrier at the metal/phosphorene...
Ngày tải lên: 06/05/2014, 08:54
phosphorene an unexplored 2d semiconductor with a high hole mobility
... epitaxial mismatch with a substrate, will change phosphorene from a direct-gap to an indirect-gap semiconductor with a significantly smaller gap Details of the computational approach are listed in the ... interface We also observe good current saturation at high drain bias values, with the highest drain current of 194 mA/mm at 1.0 μm channel length at the back gate voltage Vbg = À30 V and drain ... the mobility (ii) In a particular transistor, the current flow may not match the direction, where the material has the highest in-plane mobility (iii) The Schottky barrier at the metal/phosphorene...
Ngày tải lên: 06/05/2014, 08:58
bridge of birds a novel of an ancient china that never was
... "The sacred mountains are five in number: Hengshan, Changshan, Huashan, Taishan, and Sungshan, with Taishan leading in rank and Sungshan in the center Mountains not sacred but very distinguished ... Serenities "The cook hands the guest a ladle with an engraved handle and a stand which is placed west of the tripods," said the butler "The guest takes the handle of the ladle with his right hand, palm ... on the first common soldier named Wan All accounts agree that Wan behaved with great dignity His family was provided with a pension, and he was told that Heaven had honored him above all others,...
Ngày tải lên: 30/05/2014, 23:29
combrune - 1758 - an essay on brewing with a view of establishing the principles of the art
Ngày tải lên: 12/06/2014, 11:27
Báo cáo sinh học: " Unusual presentation of hepatitis B serological markers in an Amerindian community of Venezuela with a majority of occult cases" doc
... Loureiro,Aff2 Email: cloureir@gmail.com Domingo J Garzaro,Aff2 Email: dgarzaro@gmail.com Mar a C Duarte,Aff1 Email: mcarolad@hotmail.com Daisy M Garc a, Aff1 Email: mayilag@hotmail.com Milian C Pacheco,Aff1 ... from the Orinoco Delta (DELTA), in Yucpas (JAPREIRA) and in Yanomamis (Y) and Piaroas (P) from the Amazon (AMAZ) Figure HBV core variants circulating in a Piaroa Amerindian with OBI a Agarose ... isolate, BP21, exhibited co-circulation of a wild type virus along with a variant harboring a premature stop codon at aa 42 of the core protein, and a variant exhibiting a deletion of 28 aas (aa...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: "Comparison between 68Ga-bombesin (68Ga-BZH3) and the cRGD tetramer 68Ga-RGD4 studies in an experimental nude rat model with a neuroendocrine pancreatic tumor cell line" ppt
... O O O N H O H O N O O NH O O HO HN HN O O NH NH O NH N O H NH2 NH OH NH O O HN NH O HN O O O HN Figure O O O HN O HN N HN N NH N O O S O H O N O O NH2 H O N O O NH O O O HN HN NH HN NH2 Figure ... than 18F-FDG for the diagnosis of metastatic NETs The 68 Ga-DOTATOC uptake was also used as a parameter for a radionuclide therapy with 90 Y-DOTATOC Patients with lesions demonstrating an enhanced ... the compartment data using the formula: influx = (K1 × k3)/(k2 + k3) Compared to the standard iterative method, the machine learning method has the advantage of a fast convergence and avoidance...
Ngày tải lên: 18/06/2014, 18:20
báo cáo hóa học: " The AMC Linear Disability Score (ALDS): a cross-sectional study with a new generic instrument to measure disability applied to patients with peripheral arterial disease" potx
... for the ALDS to be valid, the ALDS scores had to show a decreasing pattern of associations, with the highest correlation with the disability related Activity domain of the VascuQol, intermediate ... The majority of the patients (71%) were male and the mean age was 68 (± 11) years Table shows the patient characteristics at time of assessment The VascuQol Total score, the VascuQol domains Activity, ... the design and revised the manuscript critically, RJH was involved in design, analysis and interpretation of the data and drafting of the manuscript All authors read and approved the final manuscript...
Ngày tải lên: 18/06/2014, 19:20