hb amp alpha and amp beta immunoreactivity in the ipf and copd lung
Báo cáo y học: "Detection of Chlamydia trachomatis-DNA in synovial fluid: evaluation of the sensitivity of different DNA extraction methods and amplification systems" pps
Ngày tải lên :
12/08/2014, 11:22
... Kit® in combination with the same amplification system The same detection limits were observed using alkaline lysis in combination with the plasmid PCR and the 16s RNA PCR as well as using the ... containing proteinase K (100 μg/ml) and incubated at 56°C over night To the samples 20 μl mM NaCl was added and samples were mixed thoroughly followed by addition of 18 μl CTAB solution and incubation ... chain reaction; PBMO = analysis peripheral blood monocytes; PCR = polymerase chain reaction; SF = synovial fluid tion of the joint, the organism is present in the SF and synovial tissue in the intracellular,...
- 10
- 403
- 0
Euro English A Debate and its Implications for Teaching English as a Foreign Language
Ngày tải lên :
26/03/2016, 13:47
... varieties and many find it hard to accept the features of Euro-English However, the teachers show a genuine interest in this topic Where there is a general preference in holding on to the guidelines ... English among the English teaching community in Germany A number of linguists claim there is a new variety of English developing in continental Europe, also known as Euro-English Their research ... participated in a survey They answered a questionnaire consisting of two parts Part one investigates the background of the teachers, their attitudes towards different varieties of English, and their...
- 6
- 503
- 0
Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt
Ngày tải lên :
08/03/2014, 10:20
... equilibrium, the concentration of deoxyHb is much greater in the low affinity cross-linked Hb Therefore, another difference between cross-linked Hb and Hb A0 may be in the binding of the deoxyHb to the ... Mansouri and Winterhalter [5] reported that the oxidation of the a chains of Hb A0 was 10 times faster than that of the beta chains and that the oxidation of the beta chains was not in uenced by pH The ... indicated that their effects upon Hb A0 and cross-linked Hb differ (Figs and vs Figs and 2) This difference in behavior of native human Hb A0 and cross-linked Hb, in the presence of the LPSs utilized,...
- 6
- 748
- 0
Báo cáo y học: "A general framework for quantifying the effects of DNA repair inhibitors on radiation sensitivity as a function of dose" pptx
Ngày tải lên :
13/08/2014, 16:21
... of these changes The main features of the method are the inclusion of an indicator term in the model to indicate the presence of the drug and a factor δx representing the variation on any parameter ... fitting was used and the significance of terms in the model was tested using the log-likelihood ratio test This test considers the ratio of the likelihood of the model with the parameter to the ... [16] and will not be discussed here In the indicator model (Equation 1), the radiosensitivity parameter change for drug-treated cells is in the form x+δx, the underlying hypothesis being that the...
- 7
- 320
- 0
Báo cáo y học: "Gene expression response in target organ and whole blood varies as a function of target organ injury phenotype" ppsx
Ngày tải lên :
14/08/2014, 20:22
... caused by the conversion of galactosamine to UDP-hexosamines and UDP-N-acetylhexosamines [31] The work was performed in its entirety using standardized procedures for the in- life work and for the generation ... (liver injury), while also differing in the extent and/ or severity of the injury and/ or the cooccurrence of other noted histopathological observations, such as the type of inflammatory cell infiltrates, ... compounds in this study were chosen based on their ability to induce acute hepatotoxicity and the similarities and differences in the type and location of the damage resulting from exposure Since the...
- 13
- 284
- 0
top-antitop cross section measurement as a function of the jet multiplicity in the final state and beyond the standard model top-antitop resonances search at the atlas detector at cern
Ngày tải lên :
22/12/2014, 22:04
... Another force included in the Standard Model is the strong interaction, which is in the domain of Quantum Chromodynamics (QCD) The strong interaction is incorporated by demanding invariance of the ... Lagrangian contains the kinetic energy of the quarks and leptons and their interactions, which is given by their coupling to the gauge fields The gauge term of the Lagrangian includes the kinetic energy ... of the top quark into a W -boson and a b-quark, while the small values of the other elements in the same row suppress the decay of the top quark into the other flavours In fact, the branching...
- 251
- 712
- 0
A study on the mutual coupling effects between 2 rectangular patch antennas as a function of their separation and angles of elevation
Ngày tải lên :
26/09/2015, 10:43
... = and Qsur 26 2.5.3 Fringing Fields In the fore-going discussion, we have assumed that the fields are contained entirely within the patch cavity The fringing fields around the patch are being ... a sin θ sin φ ] b [cos(kh cosθ )][ ] ⋅ cos[k sin θ cosφ ] cos φ sin φ , a k sin θ sin φ sin[ k (2.19) 18 where the parameters of the equations are according to the coordinate system shown in ... analyze the microstrip antenna The more common among them are the Transmission Line Model and the Cavity Model Their popularity is mainly due to their ease of use for most engineering purposes The...
- 104
- 329
- 0
Cardiovascular responses as a function of ethnicity, gender, 5HTTLPR genotype, dispositional anger and negative affect
Ngày tải lên :
02/10/2015, 22:48
... was sitting and two baseline readings when the participant was standing were taken The leads and electrodes, the BP cuff and the carrying pouch were then removed from the participant The research ... monitoring equipment When attaching the BP monitor, the BP cuff was placed with the demarcation arrow pointing at the vein on their arm, indicating proper positioning The participant was told that the ... determine the cause of these ethnic inequalities through examining ethnic differences in the prevalence of risk factors The heightened occurrence of MI among Indians in Singapore may be explained, in...
- 143
- 202
- 0
báo cáo hóa học:" Validation of a HLA-A2 tetramer flow cytometric method, IFNgamma real time RT-PCR, and IFNgamma ELISPOT for detection of immunologic response to gp100 and MelanA/MART-1 in melanoma patients" doc
Ngày tải lên :
18/06/2014, 15:20
... and quantify the analyte in the presence of other components in the sample Tetramer assay specificity is defined as TIL cells which lack binding to negative tetramer and irrelevant tetramer and ... secreting cells/well) for MART-1 This finding is due to the fact that the PBMC cell count is used as the denominator when calculating the detection frequency The lower cell number in the denominator ... providing the control and MART-1 specific Jurkat T cells and their effort to manufacture a single batch of tetramers (gp100 and MART-1) for use in both assay validation and clinical sample testing...
- 25
- 639
- 0
Báo cáo sinh học: " Comparison of real-time PCR and hemagglutination assay for quantitation of human polyomavirus JC" pptx
Ngày tải lên :
19/06/2014, 08:20
... HAU of JCV using the QIAprep® Spin Miniprep kit (Cat No 27106), according to the manufacturer's instructions and DNA was eluted in 50 µL of elution buffer [25] JCV DNA amplification and quantitation ... containing 64 HAU to 0.001 HAU of JCV DNA was extracted using a QIAprep Miniprep Spin Kit and eluted in 50 µl of the elution buffer Two µl of the 1:10 diluted template DNA was used for PCR in a final ... 3:3 and inter-run coefficients of variation for the standard curve varied from 0.06% to 4.8% and 2.6% to 5.2%, respectively, and thus appeared to be consistent for detecting and quantitating the...
- 5
- 358
- 0
báo cáo hóa học:"Comparison of real-time PCR and hemagglutination assay for quantitation of human polyomavirus JC" potx
Ngày tải lên :
20/06/2014, 04:20
... HAU of JCV using the QIAprep® Spin Miniprep kit (Cat No 27106), according to the manufacturer's instructions and DNA was eluted in 50 µL of elution buffer [25] JCV DNA amplification and quantitation ... containing 64 HAU to 0.001 HAU of JCV DNA was extracted using a QIAprep Miniprep Spin Kit and eluted in 50 µl of the elution buffer Two µl of the 1:10 diluted template DNA was used for PCR in a final ... 3:3 and inter-run coefficients of variation for the standard curve varied from 0.06% to 4.8% and 2.6% to 5.2%, respectively, and thus appeared to be consistent for detecting and quantitating the...
- 5
- 327
- 0
Báo cáo khoa học: "Genomic variability in Potato virus M and the development of RT-PCR and RFLP procedures for the detection of this virus in seed potatoes" ppt
Ngày tải lên :
12/08/2014, 04:21
... designed and coordinated the study and carried out the genetic analysis All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests ... CTTCATTTGTTATTCGACTT) and PVM2 (Forward: ATGGGAGATTCAACRAAGAA) were used for amplifying the entire CP gene and the nucleotide sequences of the amplicons (917 bp) were then determined in both directions using the ... and CL3 and group IIb consisted of CL4, Ca5 and Ca218 (Table 2, Fig 3) PVM Idaho strain and PVM isolates detected in potato samples from PEI probably have the same origin and both group IIa and...
- 7
- 452
- 0
Báo cáo y học: "DetectiV: visualization, normalization and significance testing for pathogen-detection microarray data" pot
Ngày tải lên :
14/08/2014, 08:20
... distinction between the top hit and the rest of the hits below; there are orders of magnitude between the values for both the p value and the mean normalized log ratio The other hits in the table ... significant In the three cases outlined above, there is no clear way of distinguishing the incorrect virus from the correct one There is also no consistent method of sorting or filtering the results ... both the cell-cultured samples and the infected sheep, and shows the ability of the array to distinguish between different subtypes of FMDV Discussion Developing a quick and reliable test for the...
- 12
- 221
- 0
The welfare state as a determinant of women’s health: support for women’s quality of life in Canada and four comparison nations pptx
Ngày tải lên :
22/03/2014, 11:20
... weakening of social infrastructure along the lines seen in the UK and US and to a lesser extent in Canada 9.1 Decline of the welfare state Teeple [11] sees increasing income and wealth inequalities ... Financing comes from a mix of fees and tax financing In some provinces, these fees are very low, in others, higher [78] Differences exist among provinces in integration of long-term care with the ... on reducing taxes—directly benefits the wealthy and powerful and translates into both increasing economic inequality and the weakening of communal institutions that support women [40] Nonetheless,...
- 17
- 843
- 0
Báo cáo khoa học: Combining theoretical analysis and experimental data generation reveals IRF9 as a crucial factor for accelerating interferon a-induced early antiviral signalling pdf
Ngày tải lên :
23/03/2014, 03:20
... signalling A key signalling pathway activated by type I IFN is the JAK ⁄ STAT pathway The Janus kinases JAK1 and tyrosine kinase (TYK2) are activated in response to ligand binding to the receptor, and ... (2008) Interferon-inducible protein, P56, inhibits HPV DNA replication by binding to the viral protein E1 EMBO J 27, 3311– 3321 28 Alexander WS (2002) Suppressors of cytokine signalling (SOCS) in the ... describing the experimental data was performed, and the results obtained were compared to those for the original parameter set (Fig 2A,B) The observations were comparable, indicating that they are intrinsic...
- 14
- 432
- 0
Báo cáo khoa học: "A Part of Speech Estimation Method for Japanese Unknown Words using a Statistical Model of Morphology and Context" pptx
Ngày tải lên :
23/03/2014, 19:20
... word coincides with other word in the dictionary, it is very likely to be decomposed into the dictionary word and the remaining substring We find the reason of the decomposition is that the word ... the lefthand side of Equation (7) represents the probability of the string cl Ck in the set of all strings whose length are k, while the righthand side represents the probability of the string ... number of sentences, words, and characters of the training and test sets There were 94,680 distinct words in the training test We discarded the words whose frequency was one, and made a dictionary...
- 8
- 397
- 0
A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx
Ngày tải lên :
28/03/2014, 20:20
... new during the course of the study Subjects were assessed the week prior to initiation of training and the week following the 10-week training session All assessments were videotaped and all ... concepts in partner dancing The instructor suggested the students ‘‘allow their weight to fall into the floor,’’ ‘‘reach their ears toward the ceiling,’’ ‘‘their spine is a ‘‘pearl necklace’’ and thus ... through the common mistake of pushing or pulling with their arms and hands Because students found it easier to accomplish the movements, they held hands standing in front of each other in a ‘practice’...
- 19
- 648
- 0
Chapter 2Communicating Over the Network Quangkien@gmail.com.OverviewDescribe the structure of a network, including the devices and media that are necessary for successful communications. Explain the function of protocols in network communications. Ex potx
Ngày tải lên :
01/04/2014, 12:20
... (firewalls) 14 Intermediary Devices and their Role on the Network Processes running on the intermediary network devices perform these functions: – Regenerate and retransmit data signals – Maintain information ... computer networking protocol suite The terms are often used interchangeably Strictly speaking, the suite is the definition of the protocols, and the stack is the software implementation of them 24 Network ... protocols Now – Industry standards Institute of Electrical and Electronics Engineers (IEEE) Examples: 802.3 (Ethernet), 802.11 (WLAN) Internet Engineering Task Force (IETF) Internet standards RFCs...
- 52
- 550
- 0