... Law et al Figure (see legend on previous page) Genome Biology 2005, 6:R111 http://genomebiology.com/2005/6/13/R111 http://genomebiology.com/2005/6/13/R111 Genome Biology 2005, Volume 6, Issue ... source, become better loaded with ribosomes in response to nitrogen starvation (Figure 5d) Three other examples of transcripts that run counter to general protein synthesis and become better loaded ... shock Nat Struct Biol 2003, 10:1039-1047 MacKay VL, Li X, Flory MR, Turcott E, Law GL, Serikawa KA, Xu XL, Lee H, Goodlett DR, Aebersold R, Zhao LP, Morris DR: Gene expression in yeast responding...
Ngày tải lên: 14/08/2014, 16:20
... pGEX–4T-3 (GE Healthcare, Little Chalfont, UK) using a day mutagenesis procedure [19] Specific primer pairs, pDGST–4T-3MB-f (GGATCCCCGAATTCCCGG) and pDGST–4T-3MB-r (CATGAATACTGTTTCCTG), were used for ... scanning method with a cooled CCD camera system (Ez-Capture; ATTO, Tokyo, Japan) and image analysis software (CS analyser ver 3.0; ATTO, Tokyo, Japan) The insoluble pellet was washed twice with ... fragment was inserted in frame into the XhoI site of the expression vector pGEX6P-1 (GE Healthcare, Little Chalfont, UK) to generate pGST–4AaCter 696–851 Similarly, to construct pGST– 4AaCter 852–1180,...
Ngày tải lên: 29/03/2014, 09:20
Báo cáo khoa học: Wheat germ cell-free platform for eukaryotic protein production potx
... & Mabbutt BC (2000) Dictyostelium discoideum as expression host: isotopic labeling of a recombinant glycoprotein for NMR studies Protein Expr Purif 19, 335–342 Strauss A, Bitsch F, Cutting B, ... Guignard L, Ozawa K, Pursglove SE, Otting G & Dixon NE (2002) NMR analysis of in vitro-synthesized proteins without purification: a high-throughput approach FEBS Lett 524, 159–162 17 Kohno T (2005) ... synthesized amino acids with stereo-specifically arrayed stable isotope (2H and 13C) labeling patterns that are optimal for NMR spectroscopy SAIL amino acids are being commercialized by a start-up...
Ngày tải lên: 07/03/2014, 12:20
REQUIREMENTS FOR PROTEIN MEALS FOR RUMINANT MEAT PRODUCTION IN DEVELOPING COUNTRIES pot
... diet for fattening cattle in two provinces in China[Figure 5] Cottonseed cake was the available protein source and response curves in live weight gain of young cattle to the level of cottonseed ... formaldehyde to prevent decomposition [see Silva et al [1989] for response in cattle] Cottonseed meal appears to be one of the better protected vegetable protein meals possibly combining protection from ... protein supplements to young cattle on these feeds Figure 4a shows the relationships as fitted by Poppi and McLennan [1995]and that forced through the origin The latter is a very poor fit to the...
Ngày tải lên: 08/03/2014, 23:20
Collaboration for Agriculture & Rural Development:" Sustainable and profitable development of acacia plantations for sawlog production in Vietnam - Milestone 5 " ppt
... (A mangium and A auriculiformis seed from seed orchards, and cuttings of superior acacia hybrid clones, soon to be followed by cuttings of superior A auriculiformis clones) should lift productivity ... for sawlog production One of the important challenges for plantation forestry in Vietnam is to better identify very poor sites and avoid investment in wood-producing plantations on these sites ... short as 7-8 years on productive sites in central Vietnam, slightly longer in the north and as little as years in the south The baseline internal rate of return of 24% assumes that a mean annual...
Ngày tải lên: 21/06/2014, 06:20
Methane cracking over commercial carbons for hydrogen production
... electrical heater which heats a 1/2” Schedule 40 pipe of length 300mm filled with ceramic beads (for better heat transfer) A K–type thermocouple and a Honeywell microprocessor based controller controls ... reaction temperature (850 C) under nitrogen (Purity: 99 vol% , Make: BOC India Ltd) flow On the attainment of reaction temperature, the nitrogen is slowly replaced with high purity methane (99.995 ... conversion has been estimated by analyzing the gas samples The methane conversion in mole% is plotted against time in hours (Figure 3) It may be observed from Figure that the effect of metal on...
Ngày tải lên: 05/09/2013, 15:28
The Use of Plant Cell Biotechnology for the Production of Phytochemicals
... product This is mainly attributed to the slow growth of plant cell cultures, making the depreciation costs of the bioreactor a major cost-determining factor in future attempts (Verpoorte et al., ... environmental conditions The Plackett and Burman technique was particularly useful in these cases It allows for testing of multiple variables within a single experiment (Plackett and Burman, 1946) This ... in plants encoding enzymes for fatty acid biosynthesis have been cloned This information was applied for eventual manipulation through modification of many fatty acids in transgenic plants by...
Ngày tải lên: 25/10/2013, 05:20
Tài liệu CUSTOMS DECLARATION AND LIQUIDATION SOFTWARCUSTOMS DECLARATION AND LIQUIDATION SOFTWARE USAGE GUIDLINE FOR BUSINESS - PRODUCTION TYPE ECUS_KD 1.2 docx
... No.1) Choose button “Tờ khai trị giá PP1”: 12 - The list of goods applied with Value declaration sheet measure No.1 is presented then Choose button “Thêm mới” to add more , choose button “Chi tiết” ... on button “Ghi” to save data then choose button “Chọn hàng”: 13 Put the point on the name of wanted goods then click on button “Chọn”: - Input the goods data as on paper data then choose button ... before pressing the key “F9”) - Choose the import goods list by button “>”, “>>”, or unchoose by button “
Ngày tải lên: 13/12/2013, 00:15
Tài liệu GUIDELINES FOR THE PRODUCTION, PROCESSING, LABELLING AND MARKETING OF ORGANICALLY PRODUCED FOODS docx
... Vermiculite Peat Excluding synthetic additives; permitted for seed, potting module composts Other use as recognized by certification body or authority Not permitted as a soil conditioner Humus from earthworms ... 290 Carbon Dioxide All Permitted, although exclusions of the GSFA still apply Permitted, although exclusions of the GSFA still apply 296 Malic Acid (DL-) All Permitted, although exclusions of ... Products 332i Potassium Dihydrogen Citrate All Not permitted Permitted, although exclusions of the GSFA still apply 333 Calcium Citrates All Permitted, although exclusions of the GSFA still apply 01.0...
Ngày tải lên: 14/02/2014, 03:20
Tài liệu GUIDELINES FOR THE PRODUCTION, PROCESSING, LABELLING AND MARKETING OF ORGANICALLY PRODUCED FOODS pdf
... Vermiculite Peat Excluding synthetic additives; permitted for seed, potting module composts Other use as recognized by certification body or authority Not permitted as a soil conditioner Humus from earthworms ... 290 Carbon Dioxide All Permitted, although exclusions of the GSFA still apply Permitted, although exclusions of the GSFA still apply 296 Malic Acid (DL-) All Permitted, although exclusions of ... Products 332i Potassium Dihydrogen Citrate All Not permitted Permitted, although exclusions of the GSFA still apply 333 Calcium Citrates All Permitted, although exclusions of the GSFA still apply 01.0...
Ngày tải lên: 18/02/2014, 07:20
Tài liệu Báo cáo khoa học: Cell-free translation systems for protein engineering docx
... and will contribute greatly to the field of protein science References 12 13 14 15 16 Huttenhofer A, Schattner P & Polacek N (2005) Noncoding RNAs: hope or hype? Trends Genet 21, 289–297 Costa ... Overview of antibody phagedisplay technology and its applications Methods Mol Biol 178, 1–37 Mattheakis LC, Bhatt RR & Dower WJ (1994) An in vitro polysome display system for identifying ligands from ... function Subsequently, the RNA of the selected complex is reverse transcribed (this stage can be omitted for DNAÆprotein complexes), amplified by PCR and used as the template for cell-free translation...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Environmental, Health, and Safety Guidelines for Poultry Production pptx
... should be APRIL 30, 2007 Available at: http://www.acgih.org/TLV/ and http://www.acgih.org/store/ Available at: http://www.cdc.gov/niosh/npg/ 34 Available at: http://www.osha.gov/pls/oshaweb/owadisp.show_document?p_table=STANDAR ... GROUP 3.0 References ATTRA- National Sustainable Agriculture Information service U.S Matching Livestock and Forage Resources in Controlled Grazing http://www.attra.org/attra-pub/matchlandf.html#intro ... http://www.gem.msu.edu/pubs/msue/wq19p1.html National Safety Council http://www.nsc.org/library/facts.htm includes HS e.g Ohio Livestock Manure And Wastewater Management Guide Bulletin 604 http://ohioline.osu.edu/b604/b604_15.html...
Ngày tải lên: 21/02/2014, 01:20
Tài liệu Risks and Challenges for Poultry Production doc
... a better understanding of this specific sector to be obtained The Food and Agriculture Organization of the United Nations (FAO) is implementing pilot projects in different countries to better ... and priorities of poor poultry keepers – without this understanding, attempts to introduce new technologies would have little impact in terms of poverty reduction There was a call for improvement ... including bird density, is limited In egg production, the majority of commercial layers are kept in battery cages There is wide variation in space allowance per bird from 300 to 400 cm2 in Brazil, Ukraine...
Ngày tải lên: 21/02/2014, 01:20
Tài liệu BÁO CÁO " LIPID PRODUCTION FROM MICROALGAE AS A PROMISING CANDIDATE FOR BIODIESEL PRODUCTION " ppt
... growth was slow Iwasaki et al [12] reported the similar behavior of green algae Chlorococcum littorale in which under sudden increase of CO2, activity of algae decreased temporarily and then ... and Miyachi, S., Effects of high- CO2 stress on photosystem II in a green alga, Chlorococcum littorale, which has a tolerance to high CO2, Journal of Photochemistry and Photobiology B: Biology...
Ngày tải lên: 21/02/2014, 10:20
Tài liệu BÁO CÁO " LIPID PRODUCTION FROM MICROALGAE AS A PROMISING CANDIDATE FOR BIODIESEL PRODUCTION " docx
... growth was slow Iwasaki et al [12] reported the similar behavior of green algae Chlorococcum littorale in which under sudden increase of CO2, activity of algae decreased temporarily and then ... and Miyachi, S., Effects of high- CO2 stress on photosystem II in a green alga, Chlorococcum littorale, which has a tolerance to high CO2, Journal of Photochemistry and Photobiology B: Biology...
Ngày tải lên: 21/02/2014, 10:20
Tài liệu ICC color management for print production: TAGA Annual Technical Conference 2002 ppt
... valid for selected media when scanned using reference scanner settings L*a*b* Header Private Public A2B0 B2A0 A2B1 Reference scanner settings selected B2A2 A2B3 RGB B2a1 A2B2 B2A3 Profiling package ... reference camera settings Warning: for a digital camera the viewing environment may be significantly different from that profiled In many cases the use of a standard colorspace may be a better option ... profiled monitor settings Header Private Public e1 e2 e3 e4 e5 e6 e7 e8 e9 RGB Profiling package images colored patches from target in sequence on monitor Note the monitor model, settings (WhitePoint,...
Ngày tải lên: 21/02/2014, 11:20
Tài liệu Book of Abstracts of the 60th Annual Meeting of the European Association for Animal Production docx
... local cattle breeds in France, Finland, Italy and the Netherlands A unified approach for monitoring of genetic resources in German cattle breeds 10 How to maintain declining Dutch local cattle breeds? ... cattle breeds 13 78 Performances of Bruna dels Pirineus beef cattle breed in the mountainous areas of Catalonia 14 79 Heat stress response of some local and European breeds of feedlot beef cattle ... Holstein Cattle 18 127 Estimation of genetic parameters using fixed regression model in Holstein cattle of Iran 19 128 Practical aspects of utilising gene bank stocks in commercial dairy cattle population...
Ngày tải lên: 22/02/2014, 05:20
Tài liệu INNOVATIONS FOR PAPER PRODUCTION pptx
... when he buys prints for reading books or newspapers or when he presses the button for a printout, and writing a letter or making graphs are not detrimental to the environment Paper is an important ... focus is on the improvement of strength, it is better to dose the agent at the high density area If the focus is on an increase of speed, it is better to dose the agent near the head box Results ... Production and bottling take place in Scheibbs Alex Frank 10 inside acat 2/2012 Theo Weinbrenner is responsible for the production and the raw material acquisition, Iris Spieler fills the bottles and...
Ngày tải lên: 22/02/2014, 09:20
Tài liệu Novel Design of an Integrated Pulp Mill Biorefinery for the Production of Biofuels for Transportation pot
... liquid phase reaction technologies; better heat management can be attained in a slurry phase reaction because of the presence of an inert liquid medium and better mixing The second and the third ... respectively Table 18: Coal analysis of Pittsburgh No bituminous coal sample from Washington County, Pennsylvania Pitts No Coal Component Ash Volatile Matter Fixed Carbon Carbon Hydrogen Nitrogen ... the collection of inorganic sulfur in the bottom of the reactor During that process a mixture of 12 sodium sulfide and sodium carbonate forms at the bottom of the typical recovery boiler The contents...
Ngày tải lên: 26/02/2014, 14:20
Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx
... ACACAGATCTCTGCAGGGCACCCCAGGCTTTACA and TEHA2: ACACCCATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was amplified TEHA3: ACACAGATCTCTGCAGTGAAATGAGCTGTTGACAATTA and TEHA4: ACACCCATGGTCTGTTTCCTGTG were used for trc ... 16 35 200 0.90 14 23 350 62 64 23 42 BL21(DE3) Rosetta(DE3) BL21(DE3) Rosetta(DE3) BL21(DE3) Rosetta(DE3) BL21(DE3) Rosetta(DE3) BL21(DE3) Rosetta(DE3) A O M E B 240 360 2.6 83 190 1000 300 660 ... the strain Rosetta(DE3) is the best choice Possibly more interesting is the changed expression pattern As can be seen from Table 3, the combination of the trc promoter and the Rosetta(DE3) strain...
Ngày tải lên: 06/03/2014, 01:20