gstt1 0 as a possible teratogenic allele for oral facial clefting

CRH BP as a possible diagnostic marker for hepatocellular carcinoma

CRH BP as a possible diagnostic marker for hepatocellular carcinoma

... Metastasis Metastasis Metastasis Metastasis Ref Ferguson, 200 0 Gasco, 200 2 Agirre, 200 6 Burns, 200 3 Syed, 200 6 Scolnick, 200 0 Corn, 1999 Taniguchi, 200 3 Teodoridis, 200 5 Soengas 200 1 Gifford, 200 4 ... 5’ ATGACCAGTCAACAGGGGAC 3’ 5’ CCAGCAAGCTTGCGACCTTGACCA 3’ 192 GW-CRH-BP-f 5’ AAA AAG CAG GCT CCA GCA TGT CGC CCA ACT TC 3’ GW-CRH-BP-r 5’ AGA AAG CTG GGT AAA GAC CAG ACA AAC AGA ATT C 3’ - Table ... stomach Lymphoma FANCF BRCA1 APAF1 Ovary Ovary Malignant melanoma HMLH1 Ovary MGMT Ovary, glioma, lymphoma Breast Breast Breast, thyroid, gastric Pancreas Pancreas ERβ Maspin E-cadherin Reelin DAB1...

Ngày tải lên: 04/10/2015, 08:00

103 273 0
Module 7: Microsoft Proxy Server 2.0 as a Solution for Internet Connectivity

Module 7: Microsoft Proxy Server 2.0 as a Solution for Internet Connectivity

... Network Load Balancing provides a greater benefit than round robin DNS entries because Network Load Balancing automatically excludes servers that are unavailable You can enhance the availability for ... Server as LAN interfaces are persistent, and the data rate is determined by the LAN technology Public network segments that appear as demand-dial interfaces are nonpersistent, and the data rate ... proxyarray.msft IN proxyarray.msft IN proxyarray.msft IN A A A 10. 0 .0. 1 10. 0 .0. 2 10. 0 .0. 3 When a query is made for the proxy array, the DNS server responds in a round robin order of the IP addresses In...

Ngày tải lên: 18/10/2013, 18:15

62 359 0
Báo cáo y học: "Daptomycin as a possible new treatment option for surgical management of Methicillin-Resistant Staphylococcus aureus sternal wound infection after cardiac surger" ppsx

Báo cáo y học: "Daptomycin as a possible new treatment option for surgical management of Methicillin-Resistant Staphylococcus aureus sternal wound infection after cardiac surger" ppsx

... infection after coronary artery bypass graft operation (CABG): a case report J Cardiothorac Surg 200 9, 4:47 Weis F, Beiras-Fernandez A, Kaczmarek I, Sodian R, Vicol C, Reichart B, Weis M: Daptomycin for ... colonization and infection with MRSA Standard therapy concerning antibiotic treatment has failed to eradicate the MRSA, so that we decided for an alternative antimicrobial strategy in the form of Daptomycin ... Germany) Daptomycin (4 mg/kg/day) was administered and total duration of application was ten days The wound eventually healed with no residual fistula or infection of MRSA (Figure 2) and she was...

Ngày tải lên: 10/08/2014, 09:22

3 342 1
báo cáo khoa học: " Osteonecrosis of the jaw as a possible rare side effect of annual bisphosphonate administration for osteoporosis: A case report" ppsx

báo cáo khoa học: " Osteonecrosis of the jaw as a possible rare side effect of annual bisphosphonate administration for osteoporosis: A case report" ppsx

... J Oral Maxillofac Surg 200 3, 61(9):1115-1117 Advisory Task Force on Bisphosphonate-Related Osteonecrosis of the Jaws, American Association of Oral and Maxillofacial Surgeons: American Association ... 69(1):84-91 Sambrook P, Cooper C: Osteoporosis Lancet 200 6, 67(9527): 201 0- 201 8 Ruggiero SL, Dodson TB, Assael LA, Landesberg R, Marx RE, Mehrotra B: American Association of Oral and Maxillofacial Surgeons ... Association of Oral and Maxillofacial Surgeons position paper on bisphosphonate-related osteonecrosis of the jaws J Oral Maxillofac Surg 200 7, 65(3):369-376 Walter C, Al-Nawas B, Grotz KA, Thomas C, Thuroff...

Ngày tải lên: 10/08/2014, 23:20

4 234 0
Success as a real estate agent for DUMmIES

Success as a real estate agent for DUMmIES

... change as drastically as it can in the residential arena ߜ You construct your own database Commercial real estate is a database business For example, in office leasing you have to create a database ... 24 hours a day, days a week The National Association of Realtors ran a huge marketing campaign a few years ago They circulated brochures, ran newspaper and magazine ads, and aired national TV commercials ... sought-after speakers in the real estate arena He has spoken to agents and managers at the local, regional, national, and international level for most of the large real estate brands, such as Coldwell...

Ngày tải lên: 27/03/2014, 01:27

380 902 1
Diaspora Bonds as a New Funding Vehicle for Developing Countries pdf

Diaspora Bonds as a New Funding Vehicle for Developing Countries pdf

... 1,569 1, 600 1, 400 1,3 10 1,283 1, 202 1, 200 1 ,00 0 1,145 982 1,119 1 ,04 9 1 ,00 0 924 872 785 800 600 400 200 1996 1997 1998 1999 200 0 200 1 200 2 200 3 200 4 200 5 200 6 200 7 Source: Bank of Israel The history ... migrants abroad in highincome OECD countries as of 200 0 from Docquier and Marfouk ( 200 4) -0. 52 0. 09 -0. 48 -0. 47 -0. 45 0. 32 -0. 76 -0. 55 -0. 84 -0. 60 -0. 71 -0. 81 -0. 29 0. 07 -0. 41 0. 19 -0. 77 -0. 66 0. 02 ... $25 ,00 0 4 .0 Mkt based Mkt based, 6-month Mkt based, at redemption Mkt based, 6-month Notes Mid-1970s 10 yrs yrs yrs $1 50, 000 $2 50, 000 $1 ,00 0 ,00 0 Prime based 19 80- 1992 1993-99 Since End 1999 10- 12...

Ngày tải lên: 29/03/2014, 03:20

24 298 0
ridge aperture antenna array as a high efficiency coupler for photovoltaic applications

ridge aperture antenna array as a high efficiency coupler for photovoltaic applications

... Energy 01 700 2-2 Vol 1, 201 1 Kinzel, Srigungsitthisunti, and Xu: Ridge aperture antenna array as a high efficiency coupler Fig Results for an aperture array defined by a = 7 50 nm (a) Reflection from aperture ... reflectance R (= 1−AAg −ASi , where A is absorption) for the aperture array with a = 7 50 nm, along with a = ∞ (a 225-nm thick silicon slab with no aperture array, but with a silver back layer) The figure ... Research Initiative (MURI) is gratefully acknowledged References H A Atwater and A Polman, “Plasmonics for improved photovoltaic devices,” Nature Mater 9, 205 –213 ( 201 0) K R Catchpole and A Poleman,...

Ngày tải lên: 06/05/2014, 08:54

7 297 0
ridge aperture antenna array as a high efficiency coupler for photovoltaic applications

ridge aperture antenna array as a high efficiency coupler for photovoltaic applications

... Energy 01 700 2-2 Vol 1, 201 1 Kinzel, Srigungsitthisunti, and Xu: Ridge aperture antenna array as a high efficiency coupler Fig Results for an aperture array defined by a = 7 50 nm (a) Reflection from aperture ... reflectance R (= 1−AAg −ASi , where A is absorption) for the aperture array with a = 7 50 nm, along with a = ∞ (a 225-nm thick silicon slab with no aperture array, but with a silver back layer) The figure ... Research Initiative (MURI) is gratefully acknowledged References H A Atwater and A Polman, “Plasmonics for improved photovoltaic devices,” Nature Mater 9, 205 –213 ( 201 0) K R Catchpole and A Poleman,...

Ngày tải lên: 06/05/2014, 08:58

7 302 0
Báo cáo y học: " “The non-ischemic repair” as a safe alternative method for repair of anterior post-infarction VSD" pptx

Báo cáo y học: " “The non-ischemic repair” as a safe alternative method for repair of anterior post-infarction VSD" pptx

... myocardial damage after coronary artery bypass grafting Ann Thorac Surg 200 5, 79:837-45 Weisel R: Myocardial protection during for mechanical complications of myocardial infarction Mechanical ... fibrillation J Thorac Cardiovasc Surg 1974, 68:615-25 doi: 10. 1186/1749- 809 0-5-6 Cite this article as: Apostolakis et al.: “The non-ischemic repair” as a safe alternative method for repair of anterior ... the aorta (for the cases with more than one graft) After completion of the proximal anastomoses the extracorporeal circulation is interrupted and hemostasis is performed according to the standard...

Ngày tải lên: 10/08/2014, 10:20

4 370 0
báo cáo khoa học: "Epidural varicosis as a possible cause of radicular pain: a case report" docx

báo cáo khoa học: "Epidural varicosis as a possible cause of radicular pain: a case report" docx

... embolism was found to be caused by hypoplasia of her inferior vena cava, with a bilateral occlusion of her vena iliaca communis A diagnostic evaluation showed that a collateral pathway with ectatic ... vena cava lead to significantly better results [11] This is not always possible where there is hypoplasia and/or aplasia of the inferior vena cava, so, as in our patient’s case, only symptomatic ... vena cava and bilateral deep venous thrombosis Spine (Phila Pa 1976) 200 7, 32: E688-E691 Hanley EN, Howard BH, Brigham CD, Chapman TM, Guilford WB, Coumas JM: Lumbar epidural varix as a cause...

Ngày tải lên: 10/08/2014, 22:20

3 279 0
báo cáo khoa học: " Mapping as a knowledge translation tool for Ontario Early Years Centres: views from data analysts and managers" pot

báo cáo khoa học: " Mapping as a knowledge translation tool for Ontario Early Years Centres: views from data analysts and managers" pot

... produce maps The participant explained: 'I thought that's what this was for, was to build capacity with a small little agency to be able to upload their own participation data and create a map all ... participated (representing eight teams; two of the eight teams have two data analysts and one manager, and the other six teams have one data analyst and one manager) Initially, twelve OEYC data analyst/manager ... Thousand Oaks, CA: Sage Publications; 200 0:455-486 Graham I, Logan J: Innovations in knowledge transfer and continuity of care Canadian Journal of Nursing Research 200 4, 36:89- 103 Logan J, Graham...

Ngày tải lên: 11/08/2014, 05:22

9 339 0
Báo cáo y học: " Involvement of the genicular branches in cystic adventitial disease of the popliteal artery as a possible marker of unfavourable early clinical outcome: a case report" pps

Báo cáo y học: " Involvement of the genicular branches in cystic adventitial disease of the popliteal artery as a possible marker of unfavourable early clinical outcome: a case report" pps

... popliteal artery Ann Surg 1979, 189:165-175 Cassar K, Engeset J: Cystic adventitial disease: a trap for the unwary Eur J Vasc Endovasc Surg 200 5, 29:93-96 Motaganahalli RL, Pennell RC, Mantese VA, ... treatment with percutaneous transluminal angioplasty Vasc Endovascular Surg 200 9, 43(4):399- 402 Taurino M, Rizzo L, Stella N, Mastroddi M, Conteduca F, Maggiore C, Faraglia V: Doppler ultrasonography ... popliteal artery: successful treatment with percutaneous transluminal angioplasty Vasc Endovascular Surg 200 9, 43(4):399- 402 12 Khoury M: Failed angioplasty of a popliteal artery stenosis secondary...

Ngày tải lên: 11/08/2014, 12:20

4 333 0
Báo cáo y học: " Coxiella burnetii as a possible cause of autoimmune liver disease: a case report" pps

Báo cáo y học: " Coxiella burnetii as a possible cause of autoimmune liver disease: a case report" pps

... alanine aminotransferase (ALAT, 1 20 U/L), gamma-glutamyl transferase (ү-GT, 2 40 U/L) and bilirubin (27 μmol/L) A test for malaria was negative Lumbar puncture, chest X-ray and abdominal ultrasound ... (ALAT 60 U/L, ү-GT 179 U/L) and antibody titers against Coxiella burnetii (phase I: IgG, 800 ; IgA, 0; IgM, 0; phase II: IgG, 1 600 ; IgA, 0; IgM, 0) within months of therapy (Figure 1) In May 200 6, ... such as case clustering within well-demarcated geographical areas and an increased risk of recurrence after liver transplantation with increasing immunosuppression [ 10] Escherichia coli, atypical...

Ngày tải lên: 11/08/2014, 14:20

4 340 0
báo cáo khoa học: " HIV as a chronic disease considerations for service planning in resource-poor settings" docx

báo cáo khoa học: " HIV as a chronic disease considerations for service planning in resource-poor settings" docx

... International Health 201 1 Jaffar S, Amuron B, Foster S, et al: Rates of virological failure in patients treated in a home-based versus a facility-based HIV-care model in Jinja, southeast Uganda: a ... Colebunders R, Kamya MR, Laurence J, Kambugu A, Byakwaga H, Mwebaze PS, Muganga AM, Katwere M, Katabira E: First-line antiretroviral therapy in Africa - how evidence-based are our recommendations? AIDS ... S, Akabayashi A, Kai I, Ohi G, Naka K: Correlation between history of contact with people living with HIV/AIDS (PWAs) and tolerant attitudes toward HIV/AIDS and PWAs in rural Thailand International...

Ngày tải lên: 11/08/2014, 14:21

6 291 0
báo cáo khoa học: " Mapping as a knowledge translation tool for Ontario Early Years Centres: views from data analysts and managers" pps

báo cáo khoa học: " Mapping as a knowledge translation tool for Ontario Early Years Centres: views from data analysts and managers" pps

... produce maps The participant explained: 'I thought that's what this was for, was to build capacity with a small little agency to be able to upload their own participation data and create a map all ... participated (representing eight teams; two of the eight teams have two data analysts and one manager, and the other six teams have one data analyst and one manager) Initially, twelve OEYC data analyst/manager ... Thousand Oaks, CA: Sage Publications; 200 0:455-486 Graham I, Logan J: Innovations in knowledge transfer and continuity of care Canadian Journal of Nursing Research 200 4, 36:89- 103 Logan J, Graham...

Ngày tải lên: 11/08/2014, 16:20

9 318 0
Báo cáo y học: " Cracked mercury dental amalgam as a possible cause of fever of unknown origin: a case report" docx

Báo cáo y học: " Cracked mercury dental amalgam as a possible cause of fever of unknown origin: a case report" docx

... the biochemical and clinical data GG performed the endo -oral X-ray and managed the patient MEF had the original idea and wrote the paper All authors have read and approved the final manuscript Consent ... chemical compounds Crit Rev Toxicol 200 6, 36: 609 -662 Kaufmann T, Bloch C, Schmidt W, Jonas L: Chronic inflammation and pain inside the mandibular jaw and a 10- year forgotten amalgam filling in an alveolar ... palpitations, headache and sporadic chest pain on the left side Two days later she developed a high temperature (39.1°C) which lasted day and night for three whole days and which was associated...

Ngày tải lên: 11/08/2014, 23:21

3 313 0
Báo cáo y học: " Cholestatic hepatitis as a possible new side-effect of oxycodone: a case report" pptx

Báo cáo y học: " Cholestatic hepatitis as a possible new side-effect of oxycodone: a case report" pptx

... prophylaxis Propofol 8 60 mgs and Fentanyl 300 0 micrograms were given as an infusion during and after the operation Ketamine 600 mgs was administered via intravenous infusions for analgesia The ... Journal of Medical Case Reports 200 8, 2:1 40 At the time of operation he received 20 ml 0. 5% Bupivacaine with adrenaline for local anaesthesia with g Cephalothin administered for antibiotic ... cholangiopancreatography confirmed the presence of gallstones but was otherwise unremarkable with no ductal dilatation A liver biopsy was performed and was striking for the presence of canalicular...

Ngày tải lên: 11/08/2014, 23:21

4 213 0
Báo cáo y học: "Bovine herpesvirus 4 based vector as a potential oncolytic-virus for treatment of glioma" pps

Báo cáo y học: "Bovine herpesvirus 4 based vector as a potential oncolytic-virus for treatment of glioma" pps

... T, Saika K, Sentsui H: Characterization of a bovine herpesvirus type isolated from the spinal cord of a cow with astasia Archives of virology 200 0, 145(11):2363-23 70 Redaelli M, Cavaggioni A, ... below the pial surface Injection was carried out for 16 minutes and was performed using a Hamilton syringe Animals were monitored daily for neurological signs and weight loss At the appearance of ... Wright’s stain A total of 600 cells were counted from each slide, and the percentage of apoptotic and necrotic cells was calculated At least control and treated slides were counted for each treatment...

Ngày tải lên: 12/08/2014, 02:20

6 232 0
Báo cáo y học: "Synthetic rabbit-human antibody conjugate as a control in immunoassays for immunoglobulin M specific to hepatitis E virus" ppsx

Báo cáo y học: "Synthetic rabbit-human antibody conjugate as a control in immunoassays for immunoglobulin M specific to hepatitis E virus" ppsx

... ELISA with untreated sera as a crude test to detect the HEV antibody titer The serum samples were diluted to the following dilutions 1: 100 , 1:1 ,00 0, 1: 10, 000 , and 1: 100 ,00 0 by using a coating ... Golden A, Brashear J, Robinson J, Rapp M, Klass M, Ostrow DH, Mandecki W: Recombinant mouse-human chimeric antibodies as calibrators in immunoassays that measure antibodies to Toxoplasma gondii ... 34:983-999 13 Koshy A, Grover S, Hyams KC, Shabrawy MA, Pacsa A, al-Nakib B, Zaidi SA, al-Anezi AA, al-Mufti S, Burans J, Carl M, Richards AL: Short-term IgM and IgG antibody responses to hepatitis E virus...

Ngày tải lên: 12/08/2014, 04:20

5 311 0
Báo cáo y học: " A polymorphism in the interleukin-4 receptor affects the ability of interleukin-4 to regulate Th17 cells: a possible immunoregulatory mechanism for genetic control of the severity of rheumatoid arthritis" doc

Báo cáo y học: " A polymorphism in the interleukin-4 receptor affects the ability of interleukin-4 to regulate Th17 cells: a possible immunoregulatory mechanism for genetic control of the severity of rheumatoid arthritis" doc

... variant relative to V 50 for Stat6, but not Th2 differentiation J Immunol 200 4, 173:4523-4528 Mitsuyasu H, Yanagihara Y, Mao XQ, Gao PS, Arinobu Y, Ihara K, Takabayashi A, Hara T, Enomoto T, Sasaki ... VT, USA) and analyzed by KC4 software (Biotek) Statistical analysis The data were analyzed with GraphPad Prism version 4 .02 software (GraphPad Software Inc., San Diego, CA, USA) Paired comparisons ... synovium matrix destruction in rheumatoid arthritis Cytokine 200 0, 12: 109 2- 109 9 35 Kotake S, Udagawa N, Takahashi N, Matsuzaki K, Itoh K, Ishiyama S, Saito S, Inoue K, Kamatani N, Gillespie MT, Martin...

Ngày tải lên: 12/08/2014, 15:22

9 472 0
w