grouping items by date in a pivot table

... they are grouped by year and month in the pivot table Product is in the Column Labels area, Years and Date are in the Row Labels area, and Units is in the Values area If you calculate a running ... 2008, and begins again in January 2009 51 52 CHAPTER ■ CALCULATIONS IN A PIVOT TABLE If you calculate a running total with Years as the base field: • The subtotals for Years display the running ... with a list of calculated items and a list of calculated fields 3.27 Using Formulas: Accidentally Creating a Calculated Item Problem Your pivot table contains a calculated item named Formula1,...

Ngày tải lên: 09/10/2013, 12:20

... automatically create a total for the year; you would have to create a calculation for the annual total 10 CHAPTER ■ CREATING A PIVOT TABLE You should rearrange the data, using actual dates (if available) ... visible CHAPTER ■ CREATING A PIVOT TABLE Creating an Excel Table from the Worksheet Data • As a final step in preparing the Excel source data, you should format the worksheet data as an Excel Table, ... data area CHAPTER ■ CREATING A PIVOT TABLE 1.8 Preparing the Source Data: Using an Access Query Problem The sales manager has asked you to create a pivot table from sales orders stored in a Microsoft...

Ngày tải lên: 09/10/2013, 12:20

... cell again later For other cells in the Values area, unless the PivotTable settings are changed programmatically, you can’t make any changes to the PivotTable values Even if you programmatically ... the pivot table, instead of creating records in the source data When you try to type in a cell in the Values area, you see the error message “Cannot change this part of a PivotTable report.” In ... problem by creating calculations in the source data, instead of using calculated Tip items in the pivot table You can filter the City field, to hide the rows that have a zero in the Grand Total column,...

Ngày tải lên: 09/10/2013, 12:20

... FORMATTING A PIVOT TABLE 4.17 Applying Conditional Formatting: Using Data Bars Problem You’ve created a pivot table to summarize sales for the past two years The Date field is in the Row Labels area, ... Column Labels area, and Sales is in the Values area You applied Above Average conditional formatting to the Values cells, and it is working as expected The sales manager has asked for a last-minute ... fields in your source data have line breaks (Alt+Enter) In the pivot table, these appear as a small square and question mark, instead of a line break This example is based on the LineBreak.xlsx...

Ngày tải lên: 09/10/2013, 12:20

... source data, 4–14 previewing styles, 71 print area resetting automatically, 231 adjusting automatically, 170 printed format, sharing information and, printing pivot tables 167–173 black and white, ... Preventing Layout Changes in a Pivot Table Problem In the workbook you’re sending to the regional managers, you created a SalesByDate pivot table that’s referenced in GetPivotData formulas on ... programmatically, and it allows temporary changes to the pivot table data area cells ■ Caution If you rely on pivot tables to summarize your data, you should be aware that the data can be changed, accidentally...

Ngày tải lên: 09/10/2013, 12:20

... Data: Automatically Including New Data in an External Data Range Problem In your workbook, you imported a text file that contains billing data, on to the BillingData worksheet This created an ... External Data Range is created for the imported data If you base the pivot table on this named range, it expands automatically as new records are added, and the pivot table contains all the data 143 ... Data Source Type the external data range’s sheet name and table name in the Table/ Range box For example, if the sheet name is BillingData and the external data range name is Billing_1: BillingData!Billing_1...

Ngày tải lên: 09/10/2013, 12:20

... 11-7 A GETPIVOTDATA formula extracts data from the pivot table In the summary table, use GETPIVOTDATA formulas to extract data from the pivot table In cell C4, the formula is =GETPIVOTDATA("Policies",InsurPivot! $A$ 5,"Region",$B$2, ... columns and rows that contain the headings appear on each printed page The Repeat item labels on each printed page pivot table option ensures that labels print at the top of each page if an item ... 11.5 Printing Field Items: Starting Each Item on a New Page Problem Your pivot table has Customer and Product in the row area, and when you print your pivot table, you want each customer’s data to...

Ngày tải lên: 21/10/2013, 22:20

... PUBLISHING WITH INTERACTIVITY: PIVOT CHARTS AND PIVOT TABLES Preparing the PivotTable Report Most formatting will be lost when you publish a pivot table with interactivity However, number formatting ... pivot table The Summary functions for the data fields are those that appeared in the original Excel PivotTable and can’t be changed You can create custom calculations, such as Percent of Row, Calculated ... able to make changes to the pivot table and pivot chart on the web page, such as adding and removing fields and creating formulas Office Web Components (OWCs) are created in the HTML file, based...

Ngày tải lên: 21/10/2013, 22:20

... changing PivotTable reports • Creating or changing charts or PivotChart reports • Creating lists • Creating data tables • Inserting or deleting a range of cells • Deleting worksheets • Writing, ... recording, changing, viewing, or assigning macros • Merging cells or splitting merged cells • Adding or changing conditional formats • Adding or changing data validation • Assigning, changing, ... PM Page 184 8.3 ■ USING A DATA SOURCE: ACCESS DATABASE WITH USER-LEVEL SECURITY You are trying to create a pivot table based on a table in the Access database, but you get the error message “You...

Ngày tải lên: 21/10/2013, 22:20

... Store the SQL String Me.lblSQLString.Text = strSQL ' Use the SQL String to build the data adapter and fill the data table Dim odaResults As New OleDb.OleDbDataAdapter(Me.lblSQLString.Text, _ BuildCnnStr("(local)", ... BuildCnnStr("(local)", "Northwind")) Dim dtResults As New DataTable() Try odaResults.Fill(dtResults) Catch excp As Exception MessageBox.Show(excp.Message) Exit Sub End Try ' Assign the data table to the data ... didn't have invoices; all the customers would appear, but only those invoices that had customers assigned to them would be displayed Note Normally, if your database is set up with referential integrity...

Ngày tải lên: 21/01/2014, 12:20

... proximal metaphysis in the left humerus and arthritis in the left glenohumeral joint The heart, lung and pleural space have a normal appearance, while the thymus is atrophic inadequacy of some basic ... Obstetrics Referral Hospital in Tabriz, Iran The parenteral third-generation cephalosporins appear to be a major therapeutic advance in the Ghorashi et al Journal of Medical Case Reports 2011, ... J, Palacios M, Lasheras D, Cantón R: Outbreak of a multiresistant Klebsiella pneumoniae strain in an intensive care unit: antibiotic use as risk factor for colonization and infection Clin Infect...

Ngày tải lên: 10/08/2014, 23:21

... Nonspecific and mycobacterial cultures of blood and urine, peripheral and bone marrow aspiration smears, Mantoux skin test, serological investigations for Brucella and Salmonella, abdominal ultrasonography ... normal Rheumatic and auto-inflammatory diseases including sarcoidosis and vasculitis were searched out; HLA-B27 antigen, anti-nuclear antibody, antineutrophilic cytoplasmic antibody and rheumatoid ... Egitim Hastanesi, Department of Pediatrics, Izmir, Turkey Authors’ contributions All authors have analysed and interpreted the patient data regarding the auto-inflammatory disease All authors have...

Ngày tải lên: 11/08/2014, 02:21

... manuscript CH, NA, MC and HO had significant roles in data gathering, analysis, interpretation and performing critical revisions to the manuscript AB and PC had a significant role in data gathering, ... general practitioner complaining of feeling tired and weak She had previously been fit and well, and did not take any medications Initial investigations revealed that she was in acute renal failure ... chemotherapy, in accordance with the patient's own wishes, haemodialysis was discontinued Creatinine level at this point was 650 μmol/litre At year after discontinuation of dialysis, the patient remains...

Ngày tải lên: 11/08/2014, 19:21

... present at the cell surface and in a perinuclear compartment It has been suggested that tetherin could retain viruses at the cell surface by physically linking viral and plasma membranes [3,22] A correlate ... of tetherin to an intracellular compartment by HIV anti-tetherin factors (A) The percentage of HeLa cells displaying tetherin concentrated in a perinuclear compartment (PNC) was calculated for ... Muto T, Hirota Y, Takigawa A, Fujita H, Aso Y, Amano J, Tanaka Y: HM1.24 is internalized from lipid rafts by clathrin-mediated endocytosis through interaction with alphaadaptin J Biol Chem 2009,...

Ngày tải lên: 13/08/2014, 01:20

... Lupoli K: Herbal intervention in asthma and allergy J Asthma 1999, 36:1-65 Markham AW, Wilkinson JM: Complimentary and alternative medicines (CAM) in the management of asthma: An examination of the ... (Becton-Dickinson, Mountain View, CA) and analyzed using FlowJo software (Tree Star, San Carlos, CA) RNA Isolation Total RNA was isolated using RNeasy mini kits (Qiagen, Valencia, CA) [28] Briefly, ... that NO production by Leishmania was decreased in curcumin treated BALB/c mice infected with Leishmania larvae This reduction in NO is significant as it is a salient feature of asthma and allergy...

Ngày tải lên: 13/08/2014, 13:22

... Statistics Data were recorded into a database designed with File Maker (FileMaker Inc., Santa Clara, CA, USA) We used Table National Committee on Aeronautics severity of injury or illness index (NACA) ... treating physician, and a variety of anaesthetic drugs are available to facilitate ETI Written guidelines for pre-hospital ETI were available in the Stavanger HEMS during the study period and adhered ... before arriving at the hospital or were admitted to Stavanger University Hospital We defined severe trauma as a primary diagnosis of traumatic injury and a National Committee on Aeronautics severity...

Ngày tải lên: 25/10/2012, 09:56

... α-fructosidase α-mannosidase glucosaminidase β-glucosidase α-glucosidase β-galactosidase β-glucurosidase α-galactosidase Phosphohydrolase Acid phosphatase Chemotrypsine Trypsine Cystine aminopeptidase ... aminopeptidase Valine aminopeptidase Leucine aminopeptidase Lipase (C14) Lipase (C8) Esterase (C4) Alkaline phosphatase Polysaccharidasesesrot Proteases Enzyme Figure Enzymatic profiles in wastewater under ... reactor was then inoculated with biomass prepared as indicated The sampling period determination has been described in previous research (Coulibaly et al., 2002) Wastewater Wastewater was taken...

Ngày tải lên: 05/09/2013, 09:08

... TaqMan Probes used Primer and Probe Sequence (5’-3’) Reference MF MR gacccgatgttcaagatact ctcctcccacaaatcaggac Saito et al., 2003b QMF QMR QMT (Probe) agacgcacgctcacctcaa gagcagttcacgaaatcc atacgctcttactgtttccggccgcc ... cultivation Table shows the strains examined in this study MD-1 strain was isolated from Lake Kasumigaura in Japan (Saito et al., 200 3a) MD-1 strain can degrade the microcystin analogs, microcystin-RR, ... blue-green algae, Microcystis, Anabaena, Oscillatoria and in lake Kasumigaura Environ.Tech., 14, 433-442 Park H.-D., Iwami C., Watanabe M F., Harada K.-I., Okino T and Hayashi H (1998) Temporal variabilities...

Ngày tải lên: 05/09/2013, 10:15

... label This problem is based on the DateFormat.xlsx sample workbook CHAPTER ■ GROUPING AND TOTALING PIVOT TABLE DATA Figure 5-13 Individual dates appear in the OrderDate field in the pivot table ... grouped by month and week number 5.11 Grouping Dates in One Pivot Table Affects Another Pivot Table Problem You have two pivot tables based on the same Excel Table In one pivot table, the order dates ... same value for all record, such as a or a space character, or leave all the cells blank 119 120 CHAPTER ■ GROUPING AND TOTALING PIVOT TABLE DATA c Refresh the pivot table, and then add the Avg...

Ngày tải lên: 09/10/2013, 12:20

... data, and calculate one of the grouping levels there Then, add that field to the pivot table 2.25 Grouping the Items in a Pivot Table Based on an Existing Pivot Table Problem You based one pivot ... PM Page 56 2.24 ■ GROUPING DATES BY MONTHS AND WEEKS 2.24 Grouping Dates by Months and Weeks Problem You grouped days by week, and the date range was displayed in the pivot table When you added ... column of the source data, add a date in each record If necessary, add dummy dates where no date is available If any of the rows contain text, such as N /A, replace the text with a date 6293ch02.qxd...

Ngày tải lên: 21/10/2013, 22:20