... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC...
Ngày tải lên: 23/03/2014, 13:20
... Ecuador El Salvador Granada Guatemala Guyana Haití Honduras Jamaica México Nicaragua Panamá Paraguay Perú República Dominicana Saint Kitts y Nevis San Vicente y las Granadinas Santa Luc a Surinam ... PAÍSES INDUSTRIALIZADOS Alemania Andorra Australia Austria Bélgica Canadá Chipre Dinamarca Eslovaquia Eslovenia Espa a Estados Unidos Estonia Finlandia Francia Grecia Hungr a Irlanda Islandia ... sistemas no dan abasto debido al SIDA y a la mortalidad asociada esta enfermedad En última instancia, aunque las causas de la mortalidad materna y de las lesiones y discapacidades relacionadas el...
Ngày tải lên: 28/03/2014, 23:20
báo cáo hóa học: " Development and evaluation of a computer-based medical work assessment programme" pdf
... 2: Main and second activities Status CA1 CA MA1, SA MA, SA1 MA, SA MA, SA MA, SA Event +CA2 +SA +MA2 + SA2 +CA -SA -MA Result CA1 stop CA2 start CA → MA SA start MA1 stop MA2 start SA1 stop SA2 ... complete, data from each case is transferred to a PC and evaluated statistically and graphically: the number of individual occurrences of each task, mean duration of each occurrence of each task, the ... "Stop" has to be hit At this moment all events of the observation are automatically saved in a tab-delimited file Application of the job task analysis tool The time recording software translates...
Ngày tải lên: 20/06/2014, 00:20
“The 80/20 Individual: The Nine Essentials of 80/20 Success at Work” pot
... Bezos, David Bowie, Richard Branson, Warren Buffett, Jim Clark, Bill Clinton, Larry Ellison, Bill Gates, John Grisham, Andy Grove, Tom Hanks, Robert Johnson, Michael Jordan, Nelson Mandela, Ronald ... Carnergie, Henry Ford, Bill Gates, Konosuke Matsushita, Akio Morita, hay Sam Walton – biến h a công nghiệp Con đường gian nan gai góc, loạng choạng tiến lên với can đảm phi thường cá nhân sáng ... nhà khoa học vĩ đại, từ Isaac Newton đến Charles Darwin hay Albert Einstein, mở rộng thay đổi chân trời tri thức chúng ta, nâng cao nhìn vũ trụ tiềm Những nhà kinh doanh cá nhân – Andrew Carnergie,...
Ngày tải lên: 28/06/2014, 17:21
Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country pdf
... strategy scores In table 3, the number of years working as a professional and health system research (as compared to basic research) have a significant inverse relationship with the passive strategy ... Sex (male/female) Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic ... showed that the scores of passive strategies of knowledge transfer decreased with the number of years working as a professional That is, considering that the other variables are constant, with...
Ngày tải lên: 11/08/2014, 05:21
báo cáo khoa học: " Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country" pot
... strategy scores In table 3, the number of years working as a professional and health system research (as compared to basic research) have a significant inverse relationship with the passive strategy ... Sex (male/female) Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic ... showed that the scores of passive strategies of knowledge transfer decreased with the number of years working as a professional That is, considering that the other variables are constant, with...
Ngày tải lên: 11/08/2014, 16:21
A STUDY ON IMRPOVING SPEAKING SKILL OF THE 1ST YEAR STUDENTS OF PRE INTERMEDIATE LEVEL AT FPT UNIVESITY THROUGH GROUP WORK
... teaching has primarily arisen in an attempt to capture many of the benefits associated with collaborative activities (namely peer learning and graduate attribute development) What is really group work? ... about For example, group work can dramatically increase the amount of talking for individual students, encourage border skills of participation, cooperation and negotiation, promote learner autonomy ... to Teaching English to speakers of other Languages Cross, D (1992), A practical handbook of language teaching Great Britain: Prentice Hall International Doff, A. (1988), Teach English- A training...
Ngày tải lên: 29/01/2014, 10:33
A study on an example of non-verbal interaction between the presenter and audience for English majored students at the School of Foreign Language
... use of a software package When data has been quantified, it can be used to compare and contrast other research and may be used to measure change Positivists believe that quantitative data can ... pp.19-26 Al-Issa, A (200 7a) English language teaching at the College of Law-Muscat, Sultanate of Oman: Analyzing needs and understanding problems Asian Journal of English Language Teaching, 17, ... experiences that they have accumulated through the past presentation course at the school At the time of the study, all of subjects had at least five years of English learning experience at secondary schools,...
Ngày tải lên: 19/03/2015, 10:37
Organizing pairwork and groupwork in the context of high school classrooms at pham van nghi upper secondary school, nam dinh province: A case study
... GrammarTranslation Method - a way of teaching and learning a foreign language on the basis of detailed analysis of grammar rules and application of these rules to the translation of sentences and ... years ago” 12 1.1.2 Communicative Language Teaching 1.1.2.1 Nature of Communicative Language Teaching Communicative Language Teaching means little more than an integration of grammatical and functional ... related to the study : Communicative approach to language teaching, and pairwork and groupwork in language teaching and learning 1.1 Communicative approach to language teaching 1.1.1 What is meant...
Ngày tải lên: 07/11/2012, 14:54
Inspectors and Teachers perceptions of a good English lesson
Ngày tải lên: 17/10/2013, 10:11
A STUDY ON THE DIFFICULTIES IN STUDYING TOEIC READING OF NON ENGLISH MAJORS AT ELEMENTARY LEVEL AT HAIPHONG PRIVATE UNIVERSITY
... government says the average American man eats ten grams of salt a day The American Heart Association advises no more than three grams for healthy people It says salt in the American diet has increased ... fog, a pilot must use radar, an alternative way of navigating Since human eyes are not very good at determining speeds of approaching objects, radar can show a pilot how fast nearby planes are ... about the nature of radar The radar can detect speed besides location of objects Radar use radio as type of waves Radar has improved navigational safety 4.4 Questions Before you start reading something...
Ngày tải lên: 11/12/2013, 23:53
Maximum performance a practical guide to leading and managing people at work
... cult of personality can be created and manipulated through media exploitation and propaganda, and the judicious use of the physical trappings and patronage that accompany power Stalin was a seething, ... one-off workshops or through attendance at postgraduate courses, such as MBAs and other specialist postgraduate management programmes All large companies in North America, the UK and Australasia run ... that change must be proactive rather than reactive For example, Don Argus, the former American CEO of the National Australia Bank was fond of saying that, ideally, you don’t change when you have...
Ngày tải lên: 13/12/2013, 14:54
Using compensation strategies in listening for 10th form students a case study at the high school for gifted students of vinh university
... comprehension as a process of acquiring the meaning of the message based on the incoming language data from sounds, to words, to grammatical relationships, and ultimately to the meaning Schemata are hierarchically ... compensation strategies Many studies have been done to investigate about strategies in listening According to Nunan, “learners who are aware of a range of strategies, and who are able to match ... knowledge and global understanding to comprehend the meaning of a message As Nauman (2002: 25) sees that top-down process “focus on the overall meaning of a passage and the application of schemata Schemata...
Ngày tải lên: 27/12/2013, 20:26
FOUNDERS AT WORK STORIES OF STARTUPS’ EARLY DAYS
... PM Page 17 C H A P T E R Sabeer Bhatia Cofounder, Hotmail When coworkers Sabeer Bhatia and Jack Smith began working on their first startup idea a web-based personal database they called JavaSoft—they ... Hotmail’s user base faster than any other company in his- tory at that time Do you believe it was more because you had a great product or you had a good PR campaign? Bhatia: That’s one thing about ... was working at Hewlett-Packard designing scientific calculators That was a real great opportunity to be working with the hot product of the day But what I did that led to starting a company was...
Ngày tải lên: 05/01/2014, 15:30
Tài liệu Quantification of the Health Effects of Exposure to Air Pollution: Report of a WHO Working Group pdf
... non-malignant respiratory disease It is well appreciated that deaths from chronic non-malignant respiratory disease are often misclassified as deaths from cardiovascular disease in death certificate ... that deaths take place throughout a year Without precise dates of each death, the usual (“actuarial”) convention is that about half the deaths in a year take place in each half of the year So, ... Conditional expectation of life, given achieving a certain age, can also be calculated by summing the years of life at that age and later, and dividing by the number achieving that age Some example...
Ngày tải lên: 17/02/2014, 11:20
Tài liệu FRONTIERS IN UNDERSTANDING CLIMATE CHANGE AND POLAR ECOSYSTEMS REPORT OF A WORKSHOP docx
... observations, data synthesis and management, and data dissemination and outreach Copyright © National Academy of Sciences All rights reserved Frontiers in Understanding Climate Change and Polar ... Sea ice also provides an important habitat for birds and mammals (e.g., penguins, polar bears, walrus, and seals) that use the ice as a foraging platform or breeding habitat Arctic and Antarctic ... University of Victoria, Canada SVEN D HAAKANSON, Alutiiq Museum, Kodiak, Alaska AMY LAUREN LOVECRAFT, University of Alaska, Fairbanks MOLLY MCCAMMON, Alaska Ocean Observing System, Anchorage ELLEN MOSLEY-THOMPSON,...
Ngày tải lên: 17/02/2014, 19:20
Tài liệu Báo cáo khoa học: Site-directed mutagenesis of a loop at the active site of E1 (a2b2) of the pyruvate dehydrogenase complex A possible common sequence motif docx
... mutant E1 In all assays, the E1aS283C and E1aF26 6A mutants behaved essentially the same as wild-type E1 In the DCPIP assay, the E1aY28 1A and E1aR28 2A mutants displayed a catalytic activity about ... mixture with E1 was incubated for exactly 10 at the relevant temperature and the catalytic activity at that temperature was then determined The inactivation temperatures for all the E1 mutants were ... Kinetic parameters of wild-type and mutant E1s determined by the DCPIP assay Pyruvate ThDP kcat (s)1) Wild-type E1aF26 6A E1aR26 7A E1aD27 6A E1aY28 1A E1aR28 2A E1aS283C E1aY28 1A/ R28 2A/ S28 3A E1aY28 1A/ R282A...
Ngày tải lên: 20/02/2014, 23:20
Tài liệu Báo cáo khoa học: The single tryptophan of the PsbQ protein of photosystem II is at the end of a 4-a-helical bundle domain docx
... determined numerical values of the ratio a/ b, and is the theoretical numerical value of ratio a/ b for a mixture of aromatic amino acids (Tyr and Trp), containing the same molar ratio as the protein ... were ¨ carried out in an Aktapurifier-100 apparatus (Amersham Pharmacia Biotech UK Limited) The native PsbQ protein was first passed through a cation-exchange High-Trap SP column (1 mL) (Amersham Biosciences ... concentration of mgÆmL)1 of Chl PSII-enriched membranes were incubated for h at room temperature, followed by centrifugation at 40 000 g for 30 at °C The pH of the supernatant was adjusted to a value of...
Ngày tải lên: 21/02/2014, 00:20