goethe elisabeth 1730 1808 german storyteller and mother of goethe
Introduction - German literature and philosophy
... thrust of the German Enlightenment consists, as McCarthy shows, in the use of literature and philosophy alike as the ‘epistemic tools’ (p ) of a grand, Introduction: German literature and philosophy ... disproportion between the ideals of Enlightenment and the reality of the French Revolution, and to assess the consequences of this for Germany With Schiller and Goethe, literature emerges for the ... works of Hochhuth Nicholas Saul and Weiss, the accusation of complicity and the location of the Holocaust in wider contexts of understanding dominates the literary scene If the spirit of Adorno...
- 12
- 371
- 0
Two realisms - German literature and philosophy
... practice of the s and s in Germany are his thesis of the ‘end of art’ in modernity and the analysis of the end of Romanticism which supports it Both must be understood in terms of the relationship ... tendencies of the age and indeed of occidental cultural history – perhaps the highest fulfilment of the literary side of Schlegel’s dictum of These include republican and monarchic forms of government: ... contemporary theories of the genesis of life on earth (Vulcanism and Neptunism in the persons of Anaxagoras and Thales), and even a harsh, aesthetically founded critique of the introduction of paper money...
- 62
- 357
- 0
Tài liệu Báo cáo khoa học: "Beefmoves: Dissemination, Diversity, and Dynamics of English Borrowings in a German" ppt
... ratio ˜ Uw of the actual number of users of word w (Uw ) over ˜ the expected number of users of w (Uw ), and DT = Tw ˜ is calculated analogously fo the actual/expected Tw ˜ ˜ number of threads ... in one of the German and English CELEX wordlists are automatically classified as such This improved classifier results over tokens and types, as seen in Table in the comparison of token and type ... sequences of two prefixes and/ or three suffixes Our list of affixes was built 136 from commonly-affixed stems in the MZEE corpus and a German grammar (Fagan, 2009) Compound-cutting Nominal and adjectival...
- 5
- 537
- 0
Banks’ regulatory capital buffer and the business cycle: evidence for German savings and cooperative banks pot
... Behaviour of Optimal Bank Capital Journal of Banking and Finance 28: 1469–1498 Furlong, F T and M C Keeley (1989) Capital Regulation and Bank Risk–Taking: A Note Journal of Banking and Finance ... Hamburg, M Hoffmann, J Keller 16 2005 Consumption, wealth and business cycles: why is Germany different? 17 2005 Tax incentives and the location of FDI: Thiess Buettner evidence from a panel of German ... where CAPi,t and RISKi,t are the regulatory capital and risk-weighted assets of bank i at time t The error terms vi,t and wi,t are again assumed to consist of a bank-specific component and white...
- 48
- 457
- 0
Báo cáo khoa học: "Contents and evaluation of the first Slovenian-German online dictionary" doc
... approximation of how much a dictionary user can understand of the lexical content of the newspaper text In the case of non-related lemmas, one of them is usually much more frequent (as with avto and avt), ... institution was supported by grants from the Ministry of Education, Science and Sport of the Republic of Slovenia and from the DAAD (DAAD Doktorandenstipendium im Rahmen des gemeinsamen Hochschulsonderprogramms ... Not covered lemmas and lemma sets least one of the alternative lemmas is unmarked, the underlying word form will be counted as covered Tables and show parts of the sorted result of the marking procedure...
- 4
- 321
- 0
Which interest rate scenario is the worst one for a bank? Evidence from a tracking bank approach for German savings and cooperative banks potx
... similar composition of its assets and liabilities, called 'tracking bank' We evaluate the eect of 260 historical interest rate shocks on the tracking banks of German savings banks and cooperative ... risk of of non-maturity deposits, see for instance O'Brien (2000) and Ellis and Jordan (2001) IH the positions inluded in our nlysis ount for WIFR7 of nk9s ssets nd for VVFU7 of the ... labor demand of German firms Claudia M Buch Alexander Lipponer 23 2007 International investment positions and Michael Binder exchange rate dynamics: a dynamic panel analysis Christian J Offermanns...
- 40
- 468
- 0
Báo cáo khoa học: Purification and cloning of a Delta class glutathione S-transferase displaying high peroxidase activity isolated from the German cockroach Blattella germanica pptx
... six classes of cytosolic GSTs in insects [2] The majority of GSTs are in the Delta and Epsilon classes, and the remaining enzymes are in the Omega, Sigma, Theta and Zeta classes The German cockroach ... by Edman degradation and from reported GST sequences of N lugens, Bo mori and M sexta [17–19] The 50 lL PCR reaction mixture contained 20 ng of first-strand cDNA, 0.5 nmol of forward primer [5¢CTGCCCGGATCTGCTCCCTGC(A ... sequence of DDS(L ⁄ I)YP(K ⁄ Q), appeared to be closely related to the peptide DDSLYPK identified previously in Delta class GSTs of Manduca sexta and D melanogaster [19,24] The deduced sequences of...
- 11
- 426
- 0
báo cáo hóa học:" Mothers’ knowledge and utilization of prevention of mother to child transmission services in northern Tanzania" potx
... counselling Offered test Tested Received results Exploring the mothers’: Quantification of the utilization of the PMTCT service in terms of numbers of mothers counselled and tested Attitudes to the And ... avoidance of the primary infection of the mother and avoidance of re-infection of the mother, both of which increase the risk of infecting the child Furthermore, the use of condoms is a sensitive taboo ... model: (1) the number of rooms and beds in the household and the number of people living in the household per room and per bed; (2) type of toilet, source of fuel for light and cooking; (3) assets...
- 15
- 362
- 0
báo cáo hóa học:" Levels and trends of industrial chemicals (PCBs, PFCs, PBDEs) in archived herring gull eggs from German coastal regions" pptx
... Iceland, Faroe Islands, and Norway between 2002 and 2005 [64, 65,69] and from eggs of the common eider (Somateria mollissima) from Iceland and three Norwegian sites (37 to 450 ng/g lw) in 2003 and ... mutually agreed procedure of the ESB [50] and the laboratory Details of the analytical method and instrumentation are included in Additional file Standards and reagents Native standards (BDE congeners ... Neugebauer2, and Christa Schröter-Kermani3 Fraunhofer Institute for Molecular Biology and Applied Ecology (Fraunhofer IME), Schmallenberg 57377, Germany Eurofins GfA Lab Service GmbH, Hamburg 21079, Germany...
- 29
- 417
- 0
Báo cáo lâm nghiệp: "Argan (Argania spinosa (L.) Skeels) seed germination under nursery conditions: Effect of cold storage, gibberellic acid and mother-tree genotype" docx
... Analyses of variance of emerged seedling number (ES), time to germination (TG), germination period (GP), pre-emergence dumpedoff seedling number (GC), number of deteriorated seeds (RS) and dormant ... preemergence dumped-off seedling number (GC) and number deteriorated seeds (RS) and dormant seeds (DS) for four cold storage duration and two gibberellic acid treatments (GA) Values are means of two replications ... germination and seed deterioration but none of its interaction was significant (Tab I) Therefore, cold storage and GA treatment are indifferent to genotype DISCUSSION AND CONCLUSION 4.1 Cold storage and...
- 4
- 412
- 0
Báo cáo y học: "Geographical information system and access to HIV testing, treatment and prevention of mother-to-child transmission in conflict affected Northern Uganda" pot
... Northern Uganda Ministry of Health publications 2005 Office of Prime Minister, UNDP: Northern Uganda IDP Re-profiling study UNDP/OPM Uganda 2005 Ministry of Health: Mapping and Assessment of Health ... through Uganda WHO and UNICEF offices as well as material contributions from Uganda ministry of health, bureau of statistics and district health directors of the three study districts Page of (page ... the Uganda Ministry of Health and the offices of the district directors of health services in all the three districts The methodology was also peer reviewed and approved by Uganda Ministry of Health...
- 9
- 349
- 0
Abscisic acid and gibberellin control seed germination through negative feedback regulation by MOTHER OF FT AND TFL1
... Promoter Analysis of MFT-like Subfamily Genes in Arabidopsis, Rice and Maize 137 ix LIST OF ABBREVIATIONS AND SYMBOLS LIST OF ABBREVIATIONS AND SYMBOLS Chemicals and reagents ABA ... 35S:ABI3-6HA and 35S:ABI3-6HA 96 Figure 20 Expression of ABI3, ABI5, and MFT in Germinating Seeds of 35S:ABI36HA and 35S:ABI3-6HA 97 Figure 21 ChIP Enrichment Test Showing the Binding of ABI3-6HA ... to him for offering excellent and fully professional guidance to me over the past four years of my research work in his lab His words of encouragement are always inspiring, his sense of humor makes...
- 177
- 372
- 0
Christoph bollmeyer a HIGH RESOLUTION REGIONAL REANALYSIS FOR EUROPE AND GERMAN CREATION AND VERIFICATION WITH a SPECIAL FOCUS ON THE MOISTURE BUDGET
... Federal Ministry of Transport and Digital Infrastructure (BMVI) of Germany The focus of the research project was a self-consistent assessment and analysis of regional climate in Germany and Central ... 99 II List of Figures and Tables List of Figures 1.1 Temporal and spatial scales of different global and regional reanalyses 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 The model domain of COSMO-REA6 ... documentation of the model and the description of the implementation and setup of the system producing the reanalysis will be presented in the first part of this work The second part of this work...
- 124
- 637
- 0
Chapter 4: Getting Images into and out of Photoshop
... border to clean up the edges of the selected area of color ߜ Smooth: When you click with the Magic Wand to make a selection of an area of color, you might see all kinds of tiny 1- or 2-pixel areas ... again, and repeat a number of times to create a series of paw prints marching into the distance Figure 8-14: The many faces of transformations The mask-related selection commands At the bottom of ... terms as you read about the various tools and commands with which you make selections Both feathering and anti-aliasing make the edges of your selections softer by using partially transparent or...
- 42
- 590
- 1
SAP2000® Linear and Nonlinear Static and Dynamic Analysis and Design of Three-Dimensional Structures
... and all associated documentation are proprietary and copyrighted products Worldwide rights of ownership rest with Computers and Structures, Inc Unlicensed use of the program or reproduction of ... trademark of Microsoft Corporation Adobe and Acrobat are registered trademarks of Adobe Systems Incorporated DISCLAIMER CONSIDERABLE TIME, EFFORT AND EXPENSE HAVE GONE INTO THE DEVELOPMENT AND DOCUMENTATION ... bridge spans 60 feet, and has a width and height of 12 feet each The supports are rollers at one end, and pins at the other The trusses and cross members are to be constructed of 2L4X4’s, while the...
- 47
- 1,350
- 2
SAP2000 Integrated Finite Elements Analysis and Design of Structures
... and all associated documentation are proprietary and copyrighted products Worldwide rights of ownership rest with Computers and Structures, Inc Unlicensed use of the program or reproduction of ... trademark of Microsoft Corporation DISCLAIMER CONSIDERABLE TIME, EFFORT AND EXPENSE HAVE GONE INTO THE DEVELOPMENT AND DOCUMENTATION OF SAP2000 THE PROGRAM HAS BEEN THOROUGHLY TESTED AND USED ... title of the window reads YZ Plane @ X=24 This same title also occurs on the left-hand side of the status bar at the bottom of the SAP2000 window Click the roof level beam on the left side of the...
- 127
- 1,505
- 2
The Design and Implementation of a Log-Structured File System
... areas of cost and capacity rather than performance There are two components of disk performance: transfer bandwidth and access time Although both of these factors are improving, the rate of improvement ... us to understand the effects of random access patterns and locality, both of which can be exploited to reduce the cost of cleaning The simulator models a file system as a fixed number of 4-kbyte ... on disk and in terms of how much of the data written to the log they represent More than 99% of the live data on disk consists of file data blocks and indirect blocks However, about 13% of the...
- 15
- 1,434
- 0
The Breadth and Depth of DSP
... generation and recognition are used to communicate between humans and machines Rather than using your hands and eyes, you use your mouth and ears This is very convenient when your hands and eyes ... very specialized audience State -of- the-art researchers need this kind of detailed mathematics to understand the theoretical implications of the work A basic premise of this book is that most practical ... -Simulation and modeling FIGURE 1-1 DSP has revolutionized many areas in science and engineering A few of these diverse applications are shown here Chapter 1- The Breadth and Depth of DSP in many...
- 10
- 727
- 0
Cambridge.University.Press.Fearing.Others.The.Nature.and.Treatment.of.Social.Phobia.Mar.2007.pdf
... Social phobia and disruptive social anxiety are features of the lives of many thousands of people But exactly what is social phobia? What causes it? What is its nature and what kinds of treatments ... key concepts and methods and a substantive body of research, this book aims to answer these questions and clarify social phobia by means of critical discussions and examination of evidence It ... clinicians, and students in clinical and health psychology and psychiatry AR I E L ST R AV Y N S K I is Professor of Clinical Psychology in the Department of Psychology at the University of Montreal...
- 451
- 930
- 2
Characterization and deactivation of sulfided red mud used as hydrogenation catalyst
... These samples, and samples of fresh unsulfided and sulfided catalyst, were characterized by nitrogen adsorption and SEM The results of textural characterization by nitrogen adsorption of the catalyst ... related to the intensity of emission of the characteristic Ka line of each element White corresponds to a high concentration of a given element, and black to the absence of this element, while ... Fig SEM-EDX maps of distribution of elements: red mud after h run time The brightness of every pixel of the EDX maps, B, can be quantified on a scale of (black) to (maximum degree of brightness)...
- 15
- 508
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008