get sequence value oracle c

... TBL0404 _SEQUENCE. CURRVAL INTO pID FROM DUAL; end; The Oracle sequence is shown here in Example 4-6 . Example 4-6. Sequence: TBL0404 _Sequence CREATE SEQUENCE TBL0404 _SEQUENCE INCREMENT BY ... increment, start value, maximum value, cycling, and caching can be specified when creating the sequence. Oracle stores the definition of sequences for a database in a single data dictionary table ... WITH 1 MAXVALUE 1.0E28 MINVALUE 1 NOCYCLE CACHE 20 NOORDER The C# code is shown in Example 4-7 . Example 4-7. File: OracleSequenceValuesForm.cs // Namespaces, variables, and constants...

Ngày tải lên: 21/01/2014, 11:20

... schema objects. They also control access to schema objects. xxi Chapter 9, " ;Oracle XA Library" This chapter describes the Oracle XA Library and contains a brief example of application ... Oracle resources: ■ OCCI product information page for OCCI white papers, additional examples, and so on, at http://otn .oracle. com/tech/oci/occi/index.html ■ Discussion forum for all OCCI related ... b.length(); . . . stmt->closeResultSet(rs); conn->terminateStatement(stmt); env->terminateConnection(conn); } Environment::terminateEnvironment(env); Special OCCI/SQL Terms 1-12 Oracle C+ + Call Interface Programmer's Guide In addition to calling PL/SQL stored procedures from an OCCI program, you can use PL/SQL blocks in your OCCI program...

Ngày tải lên: 18/10/2013, 17:15

... topics: ■ Overview of OCCI ■ Instant Client Feature ■ Processing of SQL Statements ■ Overview of PL/SQL ■ Special OCCI/SQL Terms ■ Object Support Overview of OCCI Oracle C+ + Call Interface (OCCI) ... connections to be opened when all the connections are busy and a call needs a connection. This increment is Overview of OCCI Introduction to OCCI 1-3 Figure 1–1 The OCCI Development Process Oracle ... OCCI Object Application 3-7 Basic Object Program Structure 3-7 Basic Object Operational Flow 3-8 Migrating C+ + Applications Using OCCI 3-12 Steps for Migration 3-12 Overview of Associative Access...

Ngày tải lên: 21/12/2013, 04:16

... (5¢-AAACTCCTCTCCAATGACG-3¢), 0.2 m M Fig. 1. Nucleotide sequence of a cDNA clone coding for a zebrafish CRBPII. The complete nucleotide sequence of the EST clone fb69e02.y1 was determined (GenBank accession ... analyzed according to the directions at (http://mgcdh1.nichd.nih.gov:8000/zfrh/beta.cgi). PCR primers (5¢-CCAGCACATCCAGCTTC-3¢)and (5¢-GCCTGTTTGGAGCATTAG-3¢) (see Fig. 1 for pri- mer location) ... (ZbfshCRBPII; GenBank Accession number AF363957), chicken CRBPII (ChickCRBPII [43]), pig CRBPII (PigCRBPII; P50121), human CRBPII (HumanCRBPII; AAC50162), rat CRBPII (RatCRBPII; P06768), mouse CRBPIII...

Ngày tải lên: 17/03/2014, 11:20

... TRẢ LỜI BÀI TẬP ORACLE Ví dụ: //Con trỏ đến c c cấu tr c handle static OCIEnv *envhp; static OCIError *errhp; static OCIServer *srvhp; //Chiều dài c c biến chuỗi int namelen=5; int ... PL/SQL đư c th c hiện như thế nào trong c c chương trình OCI? cho ví dụ. Hãy gọi hàm OCIStmtExecute() để th c thi lệnh SQL c ng như c c khôí lệnh PL/SQL c a Oracle (xem thêm lý thuyết). ... //Kết nối với c sở dữ liệu OCILogon(envhp, errhp, &srvhp, ”scott”, namelen,”tiger”, passwdlen, ”ExampleDB”,dbnamelen); 5. Điều khiển lệnh SQL hay khối lệnh PL/SQL đư c th c hiện như thế...

Ngày tải lên: 22/08/2012, 09:50

... với c sở dữ liệu Oracle bằng c c hàm trong thư viện OCI đư c th c hiện như thế nào? cho ví dụ. Kết nối và làm vi c với c sở dữ liệu Oracle thông qua c c hàm trong thư viện OCI thường th c hiện ... LỜI BÀI TẬP ORACLE CHƯƠNG 21 LẬP TRÌNH ORACLE OCI VỚI C+ + 1. Oracle OCI là gì? Lập trình và truy xuất c sở dữ liệu Oracle bằng OCI c những ưu và khuyết điểm gì so với OO4O và ODBC. Lập trình ... Một chương trình OCI c n phải c những thư viện gì khi biên dịch và th c thi? Một chương trình OCI viết bằng C+ + sau khi biên dịch ra tập tin th c thi .EXE c n phải c thêm thư viện c c file...

Ngày tải lên: 04/09/2012, 09:50

Ngày tải lên: 03/09/2013, 10:00

... Pavla C ˇ es ˇ kova ´ 2 and Miroslav Fojta 1 1 Institute of Biophysics, Academy of Sciences of the Czech Republic, Brno, Czech Republic 2 Masaryk Memorial Cancer Institute, Brno, Czech Republic The ... forms [33]. Recently, it has been reported that accessibility of the p53 CTDBS is critical for (sequence- nonspeci c) cisPt- DNA recognition [34]. On the other hand, sequence- speci c binding of ... sequence- speci c Keywords cisplatin; DNA damage; protein p73; sequence- speci c DNA recognition; tumor suppressor protein p53 Correspondence M. Fojta, Institute of Biophysics, Academy of Sciences of the Czech Republic, Kra ´ lovopolska ´ 135,...

Ngày tải lên: 19/02/2014, 05:20

... Alberta Edmonton, AB T6G 1Z2 vickie.baracos@ualberta.ca Abstract An accurate model of patient survival time can help in the treatment and care of cancer patients. The common practice of providing survival ... without an associated confidence on prediction, which is a serious drawback in clinical applications. Our MTLR model below is closely related to local regression models [11] and varying coefficient models ... measuring calibration and one measuring discriminative power (i.e., classification accuracy) of the probability predictions. Table 2 shows the classification accuracy and MSE on the predicted probabilities of different...

Ngày tải lên: 06/03/2014, 02:21

... in hairpin structure, are important in the intron knockout process and help to create complicated splicing patterns [39]. On the other hand, CA-tracts and CA-rich sequences are confirmed to be regulators ... For species specification of the LIRs, 421 (77%) are human-speci c, 355 (74%) are chimpanzee-speci c, 180 (90%) are mouse-speci c and 107 (82%) are rhe- sus monkey-speci c. For the nonspeci c LIRs, ... & Garcia-Blanco MA (2003) A stem structure in fibroblast growth factor receptor 2 transcripts mediates cell-type-speci c splicing by approximating intronic control elements. Mol Cell Biol...

Ngày tải lên: 07/03/2014, 00:20

... AAAGACACG (P8), and AAAGACAT A (P9), and their complementary sequences CATGTCTCT (P 2C) , CATGTCCTT (P 3C) , CATGTATTT (P 4C) , CATGGCTTT (P 5C) , CATCTCTTT (P 6C) , CAGGTCTTT (P 7C) , CGTGTCTTT (P 8C) , and TATGTCTTT ... (5¢- ACGCGTCGACGTCGGA AATGGAGGAGTGACGG-3¢), Hi_pDEDR (5¢- CG GGATCCCGTTAATAAAAGCCTGTTGCTGGTT-3¢), Hi_Nterm F (5¢- ACGCGTCGACGTCATGACTGCTGCT CTGGCCGT-3¢), and Hi_Nterm R (5¢- CGGGATCCCGC TGCTGGTATCGCTCCTTTG-3¢), and cloned in pPRO- TET ... 5¢-GGGGCTTGATCTCAAAATGA-3¢. The caspase-10 gene-speci c primers were: forward, 5¢-GA CGCCTTGATGCTTTCTTC-3¢; reverse, 5¢-ATGAAGGC GTTAACCACAGG-3¢. PCR conditions for these two genes were similar, except...

Ngày tải lên: 07/03/2014, 10:20

... ribonucleic acid in vitro in mitochondria from Ehrlich ascites cells. Biochemistry 22, 3151–3156. 15. Christianson, T.W. & Clayton, D.A. (1988) A tridecamer DNA sequence supports human mitochondrial ... DNA probe with nucleotide replacements targeted to the AATAAA sequence region did not bind to these protein fractions thus indicating sequence specificity. These results collectively show that ... Candia, G., Quagliariello, C. , Sbisa, E. & Saccone C. (1989) The complete nucleotide sequence of the Rattus norvegicus mitochondrial genome: cryptic signals revealed by comparative analysis between...

Ngày tải lên: 08/03/2014, 08:20

... nucleosomes in the vicinity of a sequence- speci c DNA-bound trans-acting protein does not require a context of uniformly spaced nucleosomes. With increasing ionic strength, fewer nucleosomes get aligned ... M (1993) Nucleosome positioning and transcription. Cold Spring Harb Symp Quant Biol 58, 237–245. 6 Simpson RT (1991) Nucleosome positioning: occur- rence, mechanisms and functional consequences. Prog Nucleic ... this study constitute the high-affinity, wild-type O1 oper- ator sequence of the Escherichia coli lac operon. An unidentified conformational change was reported to accompany the binding of the lac repressor...

Ngày tải lên: 16/03/2014, 10:20

... Microsoft Windows, we define the notion of correct memory management. The chapter concludes by stating the concrete semantics of Core C from which a collecting semantics is derived. 2.1 Core C ThestaticanalyserpresentedinthisbookoperatesonasimplifiedversionofC called ... specifieshowabasicblockisexe- cuted. A basic block contains either a sequence of statements or a direct or indirect function call. [[ · ]]  Next :(Σ × Θ ∗ × Δ) → (Σ × Θ ∗ × Δ) evaluates conditionals and executes the ... simply expand each function at each call site, which, in principle, incurs an exponential growth in the code size, but has been successfully applied in verification [31]. This choice also prohibits theanalysisofrecursivefunctions. Finally,...

Ngày tải lên: 19/03/2014, 14:05

... 5¢-GCGGATCCGAGGTGGTGCCAG CTGAG-3¢,5¢-GCTCTAGAGAATGGAAGCCGTGCCT G-3¢,5¢-GCTCTAGATTGGCAGATGCAGCTGAAGTA- 3¢ and 5¢-GCCTCGAGAATCAAGTGTCCCTGCACCT-3¢ (LIN-54-DCXC); 5¢-GCGGATCCGAGGTGGTGCCAGC TGAG-3¢ and 5¢-GCCTCGAGTTAAACTTCGTCTTGGC TGC-3¢ ... constructs were generated by PCR using the following primers: 5¢-GGCGGATCCAAGCCAGTGGTTGTTAAT AC-3¢ and 5¢-GCCTCGAGAATCAAGTGTCCCTGCACC T-3¢ (LIN-54-DN); 5¢-GCGGATCCGAGGTGGTGCCAG CTGAG-3¢,5¢-GCTCTAGAGAATGGAAGCCGTGCCT G-3¢,5¢-GCTCTAGATTGGCAGATGCAGCTGAAGTA- 3¢ ... a testis-speci c homolog, tesmin [14–18]. LIN54 homologs contain dual cysteine- rich domains, termed CXC, with the consensus sequence CXCX 4 CX 3 YCXCX 6 CX 3 CXCX 2 C. The two CXC domains are...

Ngày tải lên: 23/03/2014, 04:20

... extension G 5¢-GGCACTTAACCCATGGTACATGGACCTTGATATTGAC-3¢ 5¢-GTCAATATCAAGGTCCATGTACCATGGGTTAAGTGCC-3¢ R5¢-GGACCTTGATATTGACGGTCCAGATACC-3¢ 5¢-GGTATCTGGACCGTCAATATCAAGGTCC-3¢ C- terminal extension TS ... 5¢-GGATTGAAGGGGGAAGATCAGGAGGTGC-3¢ 5¢-GCACCTCCTGATCTTCCCCCTTCAATCC-3¢ Y. Sun and T. H MacRae Small heat shock protein sequence motifs FEBS Journal 272 (2005) 5230–5243 ª 2005 FEBS 5239 43 C (Fig. 1, supplemental ... localization in transfected COS-1 cells. Equal volumes of cell-free extracts were obtained from COS-1 cells transiently transfected with the vector pcDNA ⁄ 4 ⁄ TO ⁄ myc-His.A containing p26 cDNA...

Ngày tải lên: 30/03/2014, 20:20

Ngày tải lên: 18/06/2014, 17:20

Ngày tải lên: 21/06/2014, 02:20

Ngày tải lên: 23/06/2014, 00:20

Ngày tải lên: 11/07/2014, 12:20