get an html page from a site that requires authentication
creating a site that sells
... of basic human needs, which you are about to learn in the following section Human Motivators Let’s now examine basic human motivators Psychologist Abraham Maslow, bases human behavior around at ... noticeable size gains” The main purpose of a USP is to address a hole in the market place that the product can really fill Don’t forget that a USP can be incorporated into a headline or sub header in ... Concentrate on this on not features and technical specifiations Features and technical data can be used to back up your site s claims - but should not be used as the key selling tool So what? An excellent...
Ngày tải lên: 28/04/2014, 16:17
Báo cáo y học: " Arterial embolization of an extrapleural hematoma from a dislocated fracture of the lumbar spine: a case report" potx
... References Rashid MA, Wikström T, Ortenwall P: Nomenclature, classification, and significance of traumatic extrapleural hematoma J Trauma 2000, 49:286-290 Hagiwara A, Iwamoto S: Usefulness of transcatheter ... formation of a paravertebral hematoma if the parietal pleura is undamaged Spontaneous hemostasis usually occurs in these circumstances A rare case of vertebral fracture presenting with a large ... with an enlarged retroperitoneal hematoma; (3) a D-shaped opacity was seen in one part of the thoracic hematoma; and (4) after AE, the thoracic hematoma reduced in size and then disappeared Hemorrhage...
Ngày tải lên: 13/08/2014, 23:20
Manufacturing location decisions in the pharmaceutical industry an exploratory study from a network perspective
... pharmaceutical companies In April 2003, the Australian health organization suspended the manufacturing license of Pan Pharmaceuticals, Australia's largest contract manufacturer of complementary ... the meaning of firm’s capability as follows A capability, • Is a resource • Is organizationally embedded, non-transferable and firm specific, meaning that it cannot be bought as an ordinary resource ... favourable local taxation, labour practices, government incentives, favourable local rules and manufacturing legislation, favourable socio-political climate, stable exchange rate and low financial...
Ngày tải lên: 10/11/2015, 12:27
Tài liệu Báo cáo Y học: Ornithine decarboxylase-antizyme is rapidly degraded through a mechanism that requires functional ubiquitin-dependent proteolytic activity pot
... constructs encoding antizyme and the stable ODC mutant, Del6 that lacks the C-terminal destabilizing segment encompassing amino acids 423–461 The transfected cells were treated and antizyme and ODC were ... that as part of a complex that is a poor substrate for the 26S proteasome, antizyme is protected from degradation [22] We propose here an alternative possibility, that antizyme is protected from ... Matsufuji, S., Miyazaki, Y., Kanamoto, R., Kameji, T., Murakami, Y., Baby, T.G., Fujita, K., Ohno, T & Hayashi, S (1990) Analyses of ornithine decarboxylase antizyme mRNA with a cDNA cloned from...
Ngày tải lên: 22/02/2014, 04:20
How to setup a Linux system that can boot directly from a software RAID
... disks already contains data, make a backup if needed (all existing data of partitions involved in the process will be lost), and delete or resize existing partitions to create space for the software ... [root@fedora4 giotex]# mdadm manage /dev/md0 add /dev/hdc1 mdadm: hot added /dev/hdc1 [root@fedora4 giotex]# mdadm manage /dev/md1 add /dev/hdc2 mdadm: hot added /dev/hdc2 [giotex@fedora4 ~]$ cat ... process, and to train yourself, to be able to recover the system if a disk problem arises Also remember that using a RAID device does not mean you can stop doing regular backups! Version: 1.0 Created:...
Ngày tải lên: 18/09/2012, 10:11
The phenomenon of evaporative cooling from a humid surface as an alternative method for air-conditioning
... water is provided and evaporated at that temperature Isolation Non-saturated air Saturated state had sat = h1 Tad sat RH = 100 % T1 RH1/ h1 Isolation Water suppy at Tad sat Figure Adiabatic saturation ... theoretical cooling level that would be achieved in an ideal adiabatic saturation process It can be noticed that the maximum temperature that can be achieved, if water recirculated is at the saturation ... designing an indirect system is the heat-exchange surface that separates the air stream from the water to be evaporated These surfaces absorb heat from the primary air stream and transfer it...
Ngày tải lên: 05/09/2013, 16:10
Estimation of emissions of nonmethane organic compounds from a closed landfill site using a landfill gas emission model
... show the minimum and maximum annual average acceptance rates to be 999.2 mg/year and 1000.8 mg/year respectively The mean, variance, and standard deviation are 1000 mg/year, 0.0504, and 0.225 respectively ... years, and the average annual waste acceptance rate is 1000 mg/year Given that this is a conventional landfill site with inventory emission type, the methane generation rate constant, k and the ... deterministic value that was obtained before, 1.7218 x 10-7 kg/year, indicates that the uncertainty in the concentration of NMOC, annual waste acceptance rate, and the age of the landfill have significant...
Ngày tải lên: 05/09/2013, 16:11
Displaying an Image from a Database in a Web Forms Control
... containing the image from the database Create a SQL statement to retrieve the required image from the database and retrieve the image using a DataReader A DataTable or DataSet filled using a DataAdapter ... image from the database and serves it to the Image control on the web page that the client sees The following steps outline the required tasks: Create a web page that outputs a binary stream ... but not straightforward Fortunately, it is much simpler with ASP.NET than it was in ASP Two web pages are required: one that contains the user interface that the client sees and one that retrieves...
Ngày tải lên: 28/10/2013, 18:15
Displaying an Image from a Database in a Windows Forms Control
... item changes so that they can refresh their data The PropertyManager class inherits from the BindingManagerBase class and maintains the current property of an object, rather than an object in a list ... data source so that they display information from the object within the data source, such as a row in a DataTable The BindingContext class is used to instantiate a BindingManagerBase object and ... System.Data.SqlClient; private DataSet ds; private SqlDataAdapter da; private BindingManagerBase bm; // private void DisplayDatabaseImageForm_Load(object sender, System.EventArgs e) { // Create...
Ngày tải lên: 28/10/2013, 18:15
Gián án Visit from a pen pal
... - T calls or pairs to present - T evaluates 10’ 3’ Teaching date: Week :1 Period: English ...
Ngày tải lên: 29/11/2013, 15:12
An analysis of the inaugural address by g w bush in the u s president election 2004 from a perspective of discoure analysis
... retirement savings and health insurance (72) By making every citizen an agent we will give our fellow Americans greater freedom from want and fear, and make our society more prosperous and just and ... primary purpose of language is to communicate information Language, in fact, serves a great many functions Linguists, over a good many years, have attempted to understand how language works in a ... the Koran, and the varied faiths of our people (76) Americans move forward in every generation by reaffirming all that is good and true that came before - ideals of justice and conduct that are...
Ngày tải lên: 18/12/2013, 10:08
Tài liệu Creating a Class That Participates in an Automatic Transaction ppt
... in an existing transaction, to start a new transaction, or to not participate in a transaction The following steps prepare a class to participate in an automatic transaction: Derive the class from ... transactions that span multiple remote databases and multiple resource managers Objects participating in automatic transactions not need to anticipate how they might be used within a transaction ... starts a transaction if one does not exist [Transaction(TransactionOption.Required)] RequiresNew The object requires a transaction A new transaction is started for each request [Transaction(TransactionOption.RequiresNew)]...
Ngày tải lên: 24/12/2013, 05:15
Tài liệu Hyperlink from a Row in the Data Grid to a Detail Page ppt
... Private Sub Page_ Load(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles MyBase.Load 'Put user code to initialize the page here Dim odaProdIndiv As OleDb.OleDbDataAdapter odaProdIndiv ... page Listing 5.30 wfrmHowTo5_ 8a. aspx.vb: Filling and Binding the Products to the DataGrid Object Private Sub Page_ Load(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles MyBase.Load ... Open and run the Visual Basic NET-Chapter solution From the main page, click on the hyperlink with the caption How-To 5.8: Hyperlink From a Row in the Data Grid to a Detail Page You then see all...
Ngày tải lên: 21/01/2014, 12:20
Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc
... conserved active -site motifs, RHGXRXP and HD, and hydrolyze metal-free phytate with pH optima in the acidic range They consist of two domains, a large a ⁄ b domain and a small a domain with the catalytic ... Number of magnesium ions Number of sulfate ions ˚ Mean B factor (A2 ) rmsd from ideal geometry ˚ Bond lengths (A) Bond angles (°) Torsion angles (°) ˚ Planarity (A) Ramachandran statistics (according ... HAPs are adapted to different habitats To support plant growth, bacteria not need to release phosphate as fast as the diges- tive tract of an animal host, where possible substrates might be available...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf
... Considering that ankyrin B plays an important role in the membrane-blebbing process [19], DAPK-1 and s-DAPK-1 may be able to interact with ankyrin B via their ankyrin repeats and thus promote membrane ... anti-GST and anti-Flag (Sigma), and anti-PARP (Cell Signal) The ProteoExtract Subcellular Proteome Extraction Kit (Calbiochem, La Jolla, CA, USA) was used to extract proteins from mammalian cells according ... mRNA level is depicted as a ratio of DAPK-1 ⁄ s-DAPK-1 to actin (E, F) s-DAPK-1, DAPK-1 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA quantification in colon carcinoma and rectal carcinoma...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu 13 Days The Chronicle of an Escape from a German Prison doc
... darkness at that time of the year were only about five and a half Although the actual distance was a hundred and forty-five miles, allowances to be made for detours and an indirect line, as well as ... now that this was no place for me and began to make tracks as soon as she had moved away I hadn't gone a hundred yards when I heard a man's voice and the yapping of a dog come from where I had ... Blank lying at the bottom of the hedge I at once joined them, and I naturally thought that all the officers from the camp had escaped and were spread far and wide over Germany, and that I had...
Ngày tải lên: 20/02/2014, 08:20
Báo cáo khoa học: "Exploring Deterministic Constraints: From a Constrained English POS Tagger to an Efficient ILP Solution to Chinese Word Segmentation" ppt
... 47th Annual Meeting of the ACL and the 4th International Joint Conference on Natural Language Processing of the AFNLP, ACL ’09, pages 513–521 Mitch Marcus, Beatrice Santorini, and Mary Ann Marcinkiewicz ... AAAI, pages 412–418 C Kruengkrai, K Uchimoto, J Kazama, Y Wang, K Torisawa, and H Isahara 2009 An error-driven word-character hybrid model for joint chinese word segmentation and pos tagging ... the ambiguity problem that a Chinese character may appear in any relative position in a word and the out-of-vocabulary (OOV) problem that it is impossible to observe all words in training data,...
Ngày tải lên: 07/03/2014, 18:20
Báo cáo khoa học: Role of active-site residues of dispersin B, a biofilm-releasing b-hexosaminidase from a periodontal pathogen, in substrate hydrolysis pptx
... GTGAATAAAAATGCGCGGCGATGTCCAG GCTGGACATCGCCAAACATTTTTATTCACCCG CGGGTGAATAAAAATGTTTGGCGATGTCCAGC GGTGGCAACGAATTTGGTTATTCTGTGG CCACAGAATAACCAAATTCGTTGCCACC GGTGGCGATCAATTTGGTTATTCTGTGG CCACAGAATAACCAAATTGATCGCCACC ... CCACAGAATAACCAAATTGATCGCCACC GATGAATTTGGTGCGTCTGTGGAAAG CTTTCCACAGACGCACCAAATTCATC CCGAATATTGAAATTACTTATGCGAGCTATGATGGCG CGCCATCATAGCTCGCATAAGTAATTTCAATATTCGG CCTATTATCTTGCGATTGTTCCGAAAGC GCTTTCGGAACAATCGCAAGATAATAGG ... GCTTTCGGAACAATCGCAAGATAATAGG GCAGCATTATCGATCTACGGAGAAGATGC GCATCTTCTCCGTAGATCGATAATGCTGC CATTATCGATCTGGGGACAAGATGCAAAAGC GCTTTTGCATCTTGTCCCCAGATCGATAATG Forward Reverse Forward Reverse Forward Reverse Forward...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo khoa học: Possible involvement of an FKBP family member protein from a psychrotrophic bacterium Shewanella sp. SIB1 in cold-adaptation potx
... Biotechnol 1, 211–219 Kato, T., Haruki, M., Imanaka, T., Morikawa, M & Kanaya, S (2001) Isolation and characterization of psychotrophic bacteria from oil-reservoir water and oil sands Appl Microbiol ... estimated by SDS /PAGE (29 kDa) is much larger than this value (Fig 4) The molecular mass of the natural protein estimated by 2D -PAGE (28 kDa) is also much larger than that calculated from the amino ... dcm(DE3)] and plasmid pET-2 8a were purchased from Novagen Plasmid pUC18 was purchased from Takara Shuzo, Kyoto, Japan The E coli transformants were grown in Luria–Bertani medium containing 50 mgÆL)1 ampicillin...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo khoa học: Synthesis and characterization of Pi4, a scorpion toxin from Pandinus imperator that acts on K+ channels doc
... Netherlands 51 Srinivasan, K.N., Sivaraja, V., Huys, I., Sasaki, T., Cheng, B., Kumar, T.K., Sato, K & Tytgat, J., YuC., San, B.C., Ranganathan, S., Bowie, H.J., Kini, R.M & Gopalakrishnakone, ... Waard, M & Sabatier, J.M (2000) Chemical synthesis and characterization of maurocalcine, a scorpion toxin that activates Ca2+ release channel/ryanodine receptors FEBS Lett 469, 179–185 Mosbah, ... bioassays, we tested sPi4 rather than its natural counterpart as the latter is present in too low abundance in the venom of scorpion P imperator to allow a detailed analysis of its structural and...
Ngày tải lên: 17/03/2014, 10:20