genome sequence patterns and gene regulation a bioinformatics perspective

... methylmalonyl-CoA mutase; 6, methylmalonyl-CoA epimerase; 7, propionylCoA carboxylase; AAC, ATP/ADP translocator; ACP, acyl carrier protein; ALAT, alanine aminotransferase; BC-AAT, branched-chain amino acid ... Genome Res 2002, 12:1418-1427 Nozaki H, Takano H, Misumi O, Terasawa K, Matsuzaki M, Maruyama S, Nishida K, Yagisawa F, Yoshida Y, Fujiwara T, Takio S, Tamura K, Chung SJ, Nakamura S, Kuroiwa ... taxonomic home Nature 1996, 380:398 Arisue N, Hashimoto T, Yoshikawa H, Nakamura Y, Nakamura G, Nakamura F, Yano TA, Hasegawa M: Phylogenetic position of Blastocystis hominis and of stramenopiles...

Ngày tải lên: 09/08/2014, 22:24

... 5'-tcacatagaacaggcatgg-3' (143 bp); PgMYB13: 5'-aaattacagctagagtgagagg-3' and 5'-aacttgaaccgtacacgac-3' (86 bp) and EF1-α (elongation factor alpha): 5'-aactggagaaggaacccaag3' and 5'-aacgacccaatggaggatac-3', ... 5'-cattcctcaaaagcatgaagag-3' and 5'-atcgcatccacaaagtacac-3' (150 bp); CCOaOMT: 5'-attgagatcagccaaatcc-3' and 5'-gcgctctccctataatcag-3' (124 bp); AGP: 5'-gcgtccattgttttaatgtag-3' and 5'-tgtatttatccctctgtctgc3' ... (156 bp); and 5'-gagtgtggat- PgMYB8: 5'-ggtggactcagttgtaataa-3' and 5'-gtatctcacctatttacagatca-3' (101 bp); PgMYB9: 5'-gaaattcgagaaacatggtg-3' gaaatcgagaac-3' (149 bp); and 5'-aaacgaca- PgMYB10:...

Ngày tải lên: 12/08/2014, 05:20

... cerevisiae genome sequence and genome annotation files obtained from the Saccharomyces Genome Database [34] on January 29, 2004 PMs used in this work and lists of regulated genes are available as Additional ... probability matrix Additional data file is a table of the Mcm1p binding probability matrix Additional data file is a table of the Sum1p binding probability matrix Additional data file is a table ... Sum1p regulated ORFs and Ndt80p regulated ORFs) Additional data file 11 is a table listing open reading frames that are chromatin immunoprecipitated by Rap1p Additional data file 12 is a table listing...

Ngày tải lên: 14/08/2014, 14:22

... population As James William Coleman writes: The public tends to see criminals as a breed apart from ‘‘normal’’ men and women The deviants among us are commonly branded as insane, inadequate, ... commonplace – indeed, they are too commonplace to serve as a useful explanation for criminal behavior As Sutherland and Cressey argue, ‘‘though criminal behavior is an expression of general needs and ... unclear what motivates managers, many of whom are already quite wealthy, to risk everything just to gain a relatively marginal increase in income As Coleman has observed, ‘‘Criminal activities are...

Ngày tải lên: 06/03/2014, 19:20

... destroyed viable language and cultural groupings in the Americas and Australasia It is doubtful that economic globalization would have the same catastrophic impact in Europe, Asia and Africa For this ... "devastating effect of the process of language shift on actual individuals and their familial and social relations." Thirdly, in United States, Canada, the United Kingdom, Australia, New Zealand ... and universities Other traditional foreign languages like Russian, China and French have been marginalized and ignored, causing an unbalanced supply for the varied economic and political demands...

Ngày tải lên: 28/03/2014, 11:20

... Vitrain was a bright glassy band, formed from wood or bark Clarain was a smooth interlaminated band of bright and dull coal; no specific origin was postulated Durain was a dull black band and was ... (Pennsylvanian in the United States) period During this period, large areas of what is now the Eastern USA, Europe, Asia, and Australia were located near the equator and had a climate that was tropical ... India and the Wuda coalfield in Inner Mongolia Fires are also a problem in Indonesia, New Zealand, South Africa, Australia, Siberia, and other parts of the world (Masalehdani et al., 2007; Michalski,...

Ngày tải lên: 31/03/2014, 16:20

... Vitrain was a bright glassy band, formed from wood or bark Clarain was a smooth interlaminated band of bright and dull coal; no specific origin was postulated Durain was a dull black band and was ... (Pennsylvanian in the United States) period During this period, large areas of what is now the Eastern USA, Europe, Asia, and Australia were located near the equator and had a climate that was tropical ... India and the Wuda coalfield in Inner Mongolia Fires are also a problem in Indonesia, New Zealand, South Africa, Australia, Siberia, and other parts of the world (Masalehdani et al., 2007; Michalski,...

Ngày tải lên: 28/06/2014, 22:20

... pathway activates NF-κB, a primary mediator of transcriptional control and a major candidate for catabolic signaling We [13,14,18,19] and others [10,17,20] have shown that TNF-α stimulates the activation ... via interaction with the TNF-α-receptor complex and the Fas-associated protein with death domain A second pathway activates Jun-N-terminal kinases and the transcription factor AP-1 The third pathway ... the pathogenesis of chronic heart failure: immune activation and cachexia Curr Opin Cardiol 1999, 14:211-216 Moldawer LL, Sattler FR: Human immunodifficency virus-associated wasting and mechanisms...

Ngày tải lên: 12/08/2014, 18:20

Ngày tải lên: 24/11/2014, 01:47

... comparative and contrastive were employed to describe and analyze, to compare and contrast the database in order to explore similarities and differences in using English conditionals and Vietnamese ... give a comparison and contrast relevant to pragmatic properties of conditionals in English and Vietnamese equivalents A qualitative approach was also conducted to discover meanings that emerge after ... sentences are basic to the material of grammar and pragmatics, a detailed understanding of conditional sentences is vital for an accurate interpretation of its contents In consideration of the importance...

Ngày tải lên: 02/03/2015, 14:30

... Economics Teaching Program Huynh Thi Kieu Oanh ii ACRONYMS AND ABBREVIATIONS AFTA ASEAN Free Trade Agreement AICO ASEAN Industrial Cooperation Organization BBC Brand-to-Brand Complementation CEFT ... Pathom, Nonhtaburi and Pathum Thani - Zone includes Ang Thong, Autthaya, Chachoengsao, Chon Buri, Kanchanaburi, Nakhon Nayok, Phuket, Ratchaburi, Rayong, Samut Songkhram, Saraburi and Suphanburi - ... January 1st, 2000 As for AICO, the National Authority has approved most submitted applications This means that all products under application can receive full AFTA treatment Thus, Thailand has...

Ngày tải lên: 26/05/2015, 08:36

... These transnational economic transactions are sustained by social and institutional factors, such as international organizations, transnational communities, and state institutions By understanding ... literature into three strands: organizational, cognitive, and socio-institutional approaches (see Table 2-1) Proponents of organizational approaches consider firms as the main analytical focus and ... Toyota City in Japan, Pohang and Ulsan in South Korea) with many satellite plants (e.g Kumi and Changwon in South Korea, Kumamoto in Japan, and Shenzhen in China) In contrast to the mainstream...

Ngày tải lên: 09/09/2015, 10:21

... examined include: the US and Canada (North America); the United Kingdom and Germany (Europe); India and Pakistan (Asia); Australia and New Zealand (Australia); Kenya and Nigeria (Africa); Argentina ... Consequences Agency Theory; Panel data analysis Macro • • GarciaSanchez (2011) Gascó and Roy (2006) Antecedents Consequences Cross-sectional analysis based on publicly available archival data ... Cross-sectional analysis based on publicly available archival data from 173 countries Growth Theory and Human Capital Theory; Crosssectional analysis based on publicly available archival data from...

Ngày tải lên: 09/09/2015, 11:17

... Standard & Poor’s Moody’s A- Baa1 Colombia BBB- Baa3 Croatia BBB- Baa3 A Baa1 Egypt BBB- Ba2 Greece BBB- Baa1 Hungary BBB- Baa3 India BB+ Baa3 Indonesia BBB Baa3 Latvia BBB NR Oman BBB- Baa2 ... alternative loan maturity and terms: (i) a loan with a maturity of years and interest rate of 7% per year; and (ii) a loan with a maturity of 15 years and interest rate of 8% per year As expected, ... Non-Investment Grade 24 El Salvador BB NR Jordan BB- Ba3 Kazakhstan BB- Ba3 Lebanon BB- B1 Lithuania NR Ba2 Mexico BB Ba2 Moldova NR Ba2 Pakistan B+ B2 Panama BB+ Ba1 Paraguay BB- NR Peru NR...

Ngày tải lên: 21/04/2016, 13:13

... Kamaishi T, Hashimoto T, Nakamura Y, Nakamura F, Murata S, Okada N, Okamoto K, Shimizu M, Hasegawa M: Protein phylogeny of translation elongation factor EF-1 alpha suggests microsporidians are ... Antonospora and Brachiola The remaining species all branch more deeply, and O bayeri is in this tree basal to all other microsporidian species from which large genome sequence data are presently available ... Williams BA, Brown AM, Adamson ML, Keeling PJ, Fast NM: Alpha- and beta-tubulin phylogenies support a close relationship between the microsporidia Brachiola algerae and Antonospora locustae J Eukaryot...

Ngày tải lên: 09/08/2014, 20:20

... belonging to A4 6 and N1 families interfere with the TLR signalling pathway at different levels A4 6 targets all known adaptor proteins: MyD88, MAL (TIRAP), TRIF and TRAM A5 2 targets IRAK2 and TRAF6, intermediary ... poxviruses as vaccines, in particular vaccinia virus attenuated strains MVA [43,44] and NYVAC [45] that have been studied extensively [46] In comparison with strain WR, MVA lacks A5 2R and C1L genes ... where both are present in a large subset of members of N1 and A4 6 families and completely absent in others These amino acids join alpha-helices and through a potential salt bridge and probably contribute...

Ngày tải lên: 12/08/2014, 04:20

... functions as a regulator of carbon and nitrogen metabolism in A thaliana [19], but a global understanding of the genes and processes that are regulated by carbon and nitrogen signaling in plants and ... between carbon and nitrogen signaling Materials and methods Plant growth and treatment for analysis Arabidopsis thaliana seeds of the Columbia ecotype were surface-sterilized and plated on designated ... the randomized versions as many or more times than the actual promoter was determined and used to calculate a pvalue (that is, if 50 random cases as well as or better than the actual case p-value...

Ngày tải lên: 14/08/2014, 14:21

... Illumina PE read data and Illumina with Sanger PE read data (see Materials and methods: Assembling Illumina data); using Forge we assessed assemblies generated from 454 SE read data, 454 SE with Sanger ... 454 SE and Illumina PE sequence data, and developed an assembly strategy that was adaptable to evolving technologies, tools and methods Using Forge we generated a draft genome sequence with a length ... Canada (grant to JB and CB), the British Columbia Ministry of Forests (grant to SJMJ, JB and CB), the Natural Resources Canada Genomics program (grant to RCH) and Genome BC and Genome Alberta...

Ngày tải lên: 09/08/2014, 20:20

... scaffolds of PGB02 (AATTGGTCAATTCCTAAAACACCATG, AAATTATGGGTTTTAAGGGCTAGAGTTC) and PGB04 (AACAAATTTACTCATTTA CCCGTGA, CCCATCAAAATCCATGCCCAAG, TTCCAAGTTCTTGTGGGAGGAG, GACTGATTTTCTCTCCACCAAGCAAG) ... primer sequences (shown in 5'-3' orientation) are CTTTCAAGCCCAATACCCAAAGGCACTG and GGGAATGGCAATCACTGCATTGGTATAG for CYP720B4; and GGAGAATTAGTGAGTCATGTCGATG and CTCTGTCTGATTGGTGGAACAGGC for 3CAR PCR ... giberellin (GARE, TAACAGA; Pbox; GCCTTTTGAGT), auxin (ARF, TGTCTC; TGA-element, AACGAC; AUX28, ATTTATATAAAT), ethylene (ERE, AWTTCAAA), and abiotic stresses (HSE, AAAAAATTTC; MBS, TAACTG; LTR, CCGAAA)...

Ngày tải lên: 12/08/2014, 03:21