genetic markers morphological biochemical and molecular markers

... and Conclusions Chapter 4: Genetic Markers - Morphological, Biochemical and Molecular Markers 40 42 45 45 46 46 47 47 51 53 Uses and Characteristics of Genetic Markers Morphological Markers Biochemical ... Genetic Markers - Morphological, Biochemical and Molecular Markers 53 Chapter 5: Population Genetics - Gene Frequencies, Inbreeding and Forces of Evolution 75 Chapter 6: Quantitative Genetics - Polygenic ... Within-population Variation - Genetic Diversity, Mating Systems and Stand Structure Quantifying Genetic Variation Measures of Genetic Variation Based on Genetic Markers Measures of Genetic Variation Based...

Ngày tải lên: 03/04/2014, 12:12

... Müller-Starck and Ziehe (1991) Genotyping proceed Genetic control and inheritance of isoenzymes verified beforehand by utilizing full-sib families and their parents of Q robur and Q petraea (Müller-Strack ... different stands which all together belong to the same region of provenance (’multipopulation samples’); and 2) material which originates from single oak stands which cover areas of 50-100 All stands ... understanding of principles of adaptation and survival of oaks and are needed as criteria for the choice of reproductive material, for silvicultural treatment as well as for declaration and conservation...

Ngày tải lên: 08/08/2014, 19:21

... 137-149 LIEB TT O G L.D., 1984 Genetics and morphological evolution in plants Amer Nat., 123, 681-709 OSGOOD H S.M.W., MacB LT., PARSONS P.A., 1968 Genetic heterogeneity and accelerated EAN responses ... mostly genetic In an analysis of variance (ANOVA), the between-line component of variance contains a quarter of the additive genetic variance and a quarter of the dominance variance, and the ... Variation among strains expanded to an infinite size To examine the distribution of genetic variance within and between isofemale we first consider the case where strains are expanded to an infinite...

Ngày tải lên: 09/08/2014, 22:22

... acid and one aspartate aminotransferase The three-banded heterozygotes for Est-1 and Est-5 loci indicate that enzymes are at least dimers, the other enzymes being probably monomeric with two-banded ... monomorphic (Est-2 and Aat), five are diallelic (Est-1, Est-5, Acph-4, Lap-2 and Lap-4), three alleles occur at Acph-6 and Lap-3 loci, Est-4 has four alleles including a « null » allele The genetic determinism ... and is absent in China Nei’s standard genetic distances (1972) were computed to estimate the genetic differentiation between the various populations (tab] 5) The genetic distances vary from 0.001...

Ngày tải lên: 09/08/2014, 22:23

... range of molecular markers and quantitative traits [24] In Morocco, maritime pine grows in natural stands on a variety of soil types and climatic conditions, both in mountain and low lands environments ... and Australia [29] These experiments showed that morphological and adaptive traits vary significantly over the range of maritime pine On the other hand, wide-range studies using biochemical markers ... structure of morphological and anatomical traits The correlation between all morphological and anatomical traits and principal components from the PCA, with altitude, latitude, longitude and precipitation...

Ngày tải lên: 08/08/2014, 00:22

... case the individuals are the populations, and the variables are the genotypic and gametic frequencies II Material and methods Two wine cellar populations and two field populations of Drosophila ... one population to another, and when , IMURA genetic drift is the cause of the gene frequencies’ divergence (CROW & K 1970) Therefore, the cause of the maintenance of genetic polymorphism must ... chromosome, 38.8 cM) and aldehyde oxidase (Aldox locus, 3rd chromosome, 56.6 cM) The procedures for electrophoresis and staining are described by O’B & MCIN!RE (1969), I!ICKINSON (1970) and P (1957)...

Ngày tải lên: 09/08/2014, 22:22

... Seychelles and the Mascarene Islands; Southern Africa; North America (northern USA and Canada); West Indies; southern USA and Mexico; the Society Islands and Hawaii; the Far East; and Australia ... France and ex-USSR; populations of tropical regions including the West Indies, the Society Islands and Hawaii ; and populations in tropical Africa, the Seychelles and the Mascarene islands Between ... Southern USA and Mexico; and the Seychelles and the Mascarene Islands Latitudinal variations of the morphometrical traits were mainly analysed along a transect between tropical Africa and Europe...

Ngày tải lên: 14/08/2014, 19:22

... regions, will also be discussed MATERIALS AND METHODS Natural populations and morphological traits The natural populations morphological traits here studied and the techniques used (isofemale lines) ... according to Parsons (1983) and Hoffmann and Parsons (1988) Means and standard deviations of intraclass correlations are given in table IV In both species, the observed and theoretical distributions ... melanogaster and Drosophila simulans Contrasting levels of naturally occurring DNA restriction map variation and divergence Genetics 119, 875-888 Begun DJ, Aquadro CF (1991) Molecular population genetics...

Ngày tải lên: 14/08/2014, 19:22

... of bands of individuals a and b, and n the number ab b of bands shared by a and b This expression, which corresponds to the proportion of bands shared between individuals, varies from (if a and ... by Rouault and Capy (1986) and by Capy and Rouault (1987) will be proposed MATERIALS AND METHODS Basic model and identity between individuals Each individual is defined by a set of bands obtained ... shared bands; these bands being identical by state or by descent (Lynch, 1988) The expression proposed by Nei and Li (1979) will be used In this, the identity between a and b is: where na and n...

Ngày tải lên: 14/08/2014, 20:20

... genetic variation in species and among populations is important for the conservation of genetic resources The genetic diversity determination can be based on morphological, biochemical, and molecular ... Alireza Seidavi Chapter Molecular Markers and Genetic Diversity in Neotropical Felids 105 Alexeia Barufatti Grisolia and Vanessa Roma Moreno-Cotulio Chapter Genetic Diversity and Evolution of Marine ... DNA variation and the evolution, domestication and phylogeography of taurine and zebu cattle (Bos taurus and Bos indicus) Genetics 146: 1071 Manly, B F 2007 Randomization, bootstrap and Monte Carlo...

Ngày tải lên: 28/06/2014, 08:20

... a solution of α-naphtylacetate (0.2%) and β- female esterase E was monomorphic and proceeded from the female cementary gland (Beaudoin and Allais, 1991) The patterns obtained from ... populations (between 0.41 and 0.54) There was no significant difference between plain and mountain populations The Nei genetic distance matrix is given in table III and figure presents the UPGMA ... described previously (Géri and Goussard, 1984) During the same period, the Rambouillet and the two alpine populations were not affected or only slightly and their genetic polymorphism would represent...

Ngày tải lên: 08/08/2014, 18:21

... Hybridization and mating system in a mixed stand of sessile and pedunculate oak Ann Sci For 50 (suppl 1), 122s-127s Birky CW (1991) Evolution and population genetics of organelle genomes: mechanisms and ... Fairbrothers, 1987); and complex 2, comprised of Q rubra, Q marilandica, Q phellos and Q velutina (Guttman and Weight, 1989) Q alba complex This contains studied by Guttman and clustered in a complex ... species and originate from 13 references These species belong mainly to sections Lepidobalanus (white oaks) and Erythrobalanus (red oaks) and are distributed over North America, Europe and Asia...

Ngày tải lên: 08/08/2014, 19:21

... Ritland and Jain (1981) and Ritland and El Kassaby (1985) The assumptions used were those of the mixed mating model (Fyfe and Bailey, 1951): (i) each mating event is a result of either a random ... anemophilous, and self-fer- trees: Eucalyptus (Brown et al, 1975; Phillips and Brown, 1977; Moran and Brown, 1980), tropical trees (O’Malley and Bawa, 1987; tile but mainly outcrossing species (Nielsen and ... parameters is necessary to understand population genetic structures and species evolution Mating systems affect the distribution, maintenance and evolution of population genetic variability (Allard,...

Ngày tải lên: 08/08/2014, 19:21

... laricina (Cheliak and Pitel, 1985; Ying and Morgenstern, 1990) and at IDH for L laricina (Cheliak and Pitel, 1985) as well as for L occidentalis (Fins and Seeb, 1986) Lewandowski and Mejnartowicz ... investigations in larch (Cheliak and Pitel, 1985; Fins and Seeb, 1986; Lewandowski and Mejnartowicz, 1990a, b; Ying and Morgenstern, 1990) were the basis for genetic interpretation of the zymograms ... between L decidua and L occidentalis remains Genetic variability of L decidua evaluated for two Polish stands and for a seed orchard in Poland was considered to be low (Mejnartowicz and Bergmann,...

Ngày tải lên: 08/08/2014, 23:22

... of Hungary and also in Transylvania and was produced from crosses between Roman and wild pigs [1,10] Pigs from this breed were well regarded and were prize winners in the Paris (1855) and Vienna ... FUT1 and MC1R) have polymorphisms known to change gene function and phenotype, three (ESR, PRLR and MC4R) have been found to be associated with phenotypic variation and four (NRAMP1, CAST, LEP and ... reported by Sun et al [36] and it was found to be fixed in some Chinese breeds and the most common in improved breeds such as Large White and Landrace as well as Berkshire and Hampshire Allele A had...

Ngày tải lên: 09/08/2014, 18:21

... Ab and A16 for OEA-A; Bb, Be, Bd, Be, Bf, Bg, Bh, Bi, BF3, BF35, BF38 and BF418 for OEA-B; Ca, Cb and CF5 for OEA-C; Da for OEA-D; Ma and Mb for OEA-M; R and for OEA-R; F30 and F275 Hemolytic and ... Jouy-en-Josas and Lunaret) and feral ones (Corsica, Bauges, Caroux and Blood Italy) (table I) Genetic systems of transferrin and hemoglobin was detected by starch-gel electrophoresis (Nguyen and Bunch, ... result of mainland introductions from native populations on Corsican and Sardinian islands (Tomiczek, 1985; Uloth and Prien, 1985) Numerous European countries (from Spain to ex-USSR) and other parts...

Ngày tải lên: 09/08/2014, 18:21

... algorithm, initiated by Hospital [8] and developed by Fournet et al [7], uses the Monte-Carlo principle and provides the mean values and standard deviations for genetic mean and variance over time a 2.2 ... a decrease in genetic variability over time, due to genetic drift and selection, until the exhaustion of variance in many cases Therefore, thorough knowledge of the evolution of genetic variance ... / sélection / petite population INTRODUCTION Genetic variability is necessary to provide genetic progress through selection and the conservation of genetic variability is of increasing concern...

Ngày tải lên: 09/08/2014, 18:22

... aggregation and fragmentation of proteins and DNA damage [22] Thioredoxin peroxidase (TSA1) and thioredoxin (TRX2) function in redox homeostasis and are regulated by the transcription factors Yap1p and ... SUP35, 5'AAAATCCCAACCCTACGGTA and 5'CCACTGTAGCCGGATACTGGCA, respectively For each strain both DNA strands were sequenced and analyzed using Phred, Phrap and Consed [62] and polymorphic sites were ... [http://www.genetics.wustl.edu/ jflab] Phred, Phrap, Consed [http://www.phrap.org/] Rozas J, Rozas R: DnaSP version 3: an integrated program for molecular population genetics and molecular evolution...

Ngày tải lên: 09/08/2014, 20:20

... in figure and tables and : the cumulated selection differentials and the cumulated responses are given in table ; the realised heritabilities (see fig B) and the estimated additive genetic variances ... dominance, and genetic variation Heredity, 48, 63-78 EMPLETON T A.R., 1979 The unit of selection in Drosophila mercatorum II - Genetic revolution and the origin of coadapted genomes in parthenogenetic ... Oregon strain were placed in population cages at 21°, 25° and 29 °C, respectively The 2 1and 25 °C populations expanded rapidly in number and attained, after a few weeks, a stable population size...

Ngày tải lên: 09/08/2014, 22:23

... collection and analysed the results FC performed the statistical analysis RN, ML, AC, VA, DP and RC partecipated to acquisition of data AQ conceived the study and partecipated in its design and coordination ... Nelissen I, Fiten P, Vandenbroeck K, Hillert J, Olsson T, Marrosu MG, Opdenakker G: PECAM1, MPO and PRKAR1A at chromosome 17q21-q24 and susceptibility for multiple sclerosis in Sweden and Sardinia Neuroimmunol ... in greater detail elsewhere [10] Informed consent to perform molecular genetic studies was obtained from all patients a power of 80% and a significance level of 0.05, the power calculation for...

Ngày tải lên: 11/08/2014, 08:20