general aspects in the choice of a model

... sound influence on behavioral and attitudinal aspects of individuals An in- depth analysis in each of the broad parameters revealed the following: Educational Facet Education plays a vital role in ... MFIs amongst lower income populations The data was tabulated and analyzed through qualitative analysis of the gathered data, which reveal the behaviors and decision making patterns in lower income ... limited by all the MFIs operating in Pakistan The average loan size in Pakistan is ranging from 10,000- 15,000 only Keeping in mind the inflation and ever increasing price in Pakistan, the loan size...

Ngày tải lên: 06/09/2013, 05:48

... wellknown advantage of these models is that they can provide an efficient summary of the data via a small number of meaningful parameters, the significance of which does not change with the trials ... METHODS The models were tested with a data set containing 44 trees belonging to 13 good growing stands, sampled in the Landes de Gascogne area and aged more than 35 years to get the main part of the ... convenient means of studying the repartition of information along the time scale For a model f(t,&thetas;), depending on the parameter vector &thetas;, the sensitivity function of a parameter &isateht...

Ngày tải lên: 08/08/2014, 19:21

... nature to a data manager which fails to free data, but is easier to detect and prevent • Data manager changes data A malicious data manager may change the value of its data on each cache refresh ... when the data manager relinquishes that memory If the data manager does not process and release the data within an adequate period of time, the data may then be paged out to the default pager In ... when it initiates a cache replacement A data manager may restrict the use of cached data by issuing a pager_data_lock request, specifying the types of access (any combination of read, write, and...

Ngày tải lên: 12/09/2012, 15:05

... important to differentiate whether CSM is focusing on the satisfaction of the customer organization as a whole or the satisfaction of certain individuals within that organization These are clearly ... expectations and the performance of the organization’s offerings (see e.g Parasuraman et al., 1985 & 1988 & 1991) Another stream of research is the performance-based approach (or linear regression approach) ... ABSTRACT There is a lack of research that focuses on the suitability of the concept of customer satisfaction and the current methods used for measuring it in organizations operating in business-to-business...

Ngày tải lên: 15/01/2014, 15:59

... (a) In the absence of one or more integral membrane subunits the majority of the subunits in the peripheral-subcomplex are accumulated in a stable form, and most likely already associated in a ... of the known mammalian ESSS proteins reveals a high degree of conservation in the C-terminal domain (including the transmembrane region), but a significant number of differences in the N-terminal ... Each of the mutants was found to have a premature chain-termination codon within the open reading frame In two of the mutants (CCL16-B11 and V79-G18) the predicted protein is truncated at a position...

Ngày tải lên: 19/02/2014, 16:20

... memories are of viewing seminal national events: the first moon landing, the Viet24 BUT FOR THE WEATHER nam War, and the Watergate hearings While the moon landing produced the sort of cheering and ... mother -in- law, Karin’s — then passed through the second floor of the house next door and landed in the third, killing the family hiding in the basement Karin’s family, having taken cover in their ... incursions, a corridor with watchdogs, and tripwires attached to machine guns The final barrier always consisted of the Mauer feindwärts, the “wall facing the enemy.” The view of the Wall from East and...

Ngày tải lên: 22/02/2014, 06:20

... unhappiness, was the fact that my brother William was purchased by the same family My father, by his nature, as well as by the habit of transacting business as a skillful mechanic, had more of the ... that I did not live on a distant plantation, but in a town not so large that the inhabitants were ignorant of each other's affairs Bad as are the laws and customs in a slaveholding community, the ... coursing in the veins of American slaves? I have spoken of the pains slaveholders take to give their slaves a bad opinion of the north; but, notwithstanding this, intelligent slaves are aware that...

Ngày tải lên: 15/03/2014, 03:20

... contains 535 amino acids with a calculated average molecular mass of 57 752 Da and the a- subunit contains 808 amino acids with a calculated average molecular mass of 87 392 Da The total calculated ... (ggcaggaattgaatgcag) or the known 3¢ end of the xdhB gene (gcccagtacctacaagattc) Localization of xdhAB genes on the C acidovorans plasmid was established using the AlkPhos Fig Location of the ... and characterization of xanthine dehydrogenase in a baculovirus-insect cell system In Flavins and Flavoproteins 1993 Proceedings of the 11th International Symposium on Flavins and Flavoproteins...

Ngày tải lên: 16/03/2014, 23:20

... homogenates of male and female antennae contained an immunoreactive band with an apparent molecular mass of 40 kDa (Fig 1, left, A, B) In the sample of primary cell culture of M brassicae, a band ... sequence analysis revealed that the cDNA contains a putative coding region of 1059 bp, encoding a 353 amino-acid protein with a theoretical molecular mass of 41 400 Da and an isoelectric point of 5.35, ... hairs are distributed in two classes according to their length The long ones (long sensilla trichodea) are located on the lateral part of the ventral area and are arrayed in four to five parallel...

Ngày tải lên: 17/03/2014, 23:20

Ngày tải lên: 21/03/2014, 22:04

... indicating that the dominant effect of the Ca2+ concentration appears Fig Autocatalytic activation of trypsinogen by trypsin in the absence or presence of p-amindinobenzamidine (A) Effect of trypsinogen ... Trypsin catalyzes the activation of trypsinogen in an intermolecular autocatalytic process The conversion of trypsinogen to trypsin involves the removal of the N-terminal hexapeptide H2N-Val-AspAsp-Asp-Asp-Lys ... period, a rapid increase in trypsin activity was observed The lag phase of the S-shaped activation curve is shortened by an increase in the trypsinogen concentration, and the maximal trypsin activity...

Ngày tải lên: 23/03/2014, 13:20

... feedback about impossible word candidates • We have been able to incorporate the durational information from Bear and Price quite easily into our framework An advantage of our approach is that the ... prosodic information is added as constraints instead of incorporating it into a parsing grammar Because CDG is more expressive than context-free grammars, we can produce prosodic rules that are more ... Harper Parsec: An architecture for parallel parsing of constraint dependency grammars In Submitted to The Proceedings o /the ~9th Annual Meeting o.f ACL, June 1991 [3] H Maruyama Constraint dependency...

Ngày tải lên: 23/03/2014, 20:20

... ELISA-assay remained negative throughout follow-up in of the seven cases (Table 1) We also investigated reactivity against single HCV proteins by the INNO-LIA HCV III assay A faint band against the ... experiments To avoid inter-assay variability, all serial samples follow-up of one individual were tested in the same assay A stimulation index (SI) of >2.5 in the proliferation assay was considered ... proteins) (*) Patient 13 had a faint band against the C2 protein at the second time point investigated (after HCV clearance) (**) Patient 80 had HCV serotype Genotyping was not performed in the initial...

Ngày tải lên: 18/06/2014, 18:20

... that children ages 8–17 can talk about and respond to items asking them about their health and well-being They can also offer unique insight into the understandability of the items These findings ... agreed to allow their child to participate, they were scheduled for an interview date At the time of the interview, a trained research assistant obtained parental informed consent and the children ... items, and the basis for the response for each item [9] Cognitive probes elicit information regarding the clarity and rationale of the directions, the meaning of the items, the appropriateness of the...

Ngày tải lên: 18/06/2014, 19:20

... draft the manuscript AlexP participated in the design of the study and drafted the manuscript Both authors read and approved the final manuscript Acknowledgements 18 19 The authors thank Prof ... recombination awaits further investigation Conclusion The data presented in this paper show that the recTULV presents no real match to the original cell adapted variant and that the lower fitness of the ... nonpairing C /A bases in the minus-sense RNA Interestingly, in Puumala hantavirus, a hairpin-like structure formed by a highly conserved inverted repeat in the 3'-noncoding region of the S segment...

Ngày tải lên: 18/06/2014, 22:20

... signal or the output of an actual switch Such signals can be used to label the brain signals and to evaluate the performance of a BI The data analysis of individuals with motor disabilities was ... discard the least informative features based on the amount of information that each feature carries regarding the output classes presence of feature i and a value of "0" indicated its absence in ... over an interval containing the movement onset (measured as the finger switch activation) if no artifact was detected in that particular interval The interval starts at tstart seconds before Page...

Ngày tải lên: 19/06/2014, 10:20

... ELISA-assay remained negative throughout follow-up in of the seven cases (Table 1) We also investigated reactivity against single HCV proteins by the INNO-LIA HCV III assay A faint band against the ... experiments To avoid inter-assay variability, all serial samples follow-up of one individual were tested in the same assay A stimulation index (SI) of >2.5 in the proliferation assay was considered ... proteins) (*) Patient 13 had a faint band against the C2 protein at the second time point investigated (after HCV clearance) (**) Patient 80 had HCV serotype Genotyping was not performed in the initial...

Ngày tải lên: 20/06/2014, 01:20

... draft the manuscript AlexP participated in the design of the study and drafted the manuscript Both authors read and approved the final manuscript Acknowledgements 18 19 The authors thank Prof ... recombination awaits further investigation Conclusion The data presented in this paper show that the recTULV presents no real match to the original cell adapted variant and that the lower fitness of the ... nonpairing C /A bases in the minus-sense RNA Interestingly, in Puumala hantavirus, a hairpin-like structure formed by a highly conserved inverted repeat in the 3'-noncoding region of the S segment...

Ngày tải lên: 20/06/2014, 04:20

... Tretiakova M, Jagadeeswaran S, Montag A, Becker A, Kenny HA, Peter ME, Ramakrishnan V, Yamada SD, Lengyel E: Loss of E-cadherin promotes ovarian cancer metastasis via alpha 5-integrin, which is a ... understanding of the normal mechanisms could reveal the aberrant features that mediate and maintain the transformed state, especially in solid malignancies [87,89,98] miRNA as targets and/or mediators of ... Mulligan J: Monitoring gene expression profile changes in ovarian carcinomas using cDNA microarray Gene 1999, 229:101-108 Ono K, Tanaka T, Tsunoda T, Kitahara O, Kihara C, Okamoto A, Ochiai K, Takagi...

Ngày tải lên: 20/06/2014, 07:20

... perpendicular external magnetic field, both for the case of a single potential kink, as well as for a kink-antikink pair One advantage of such a setup is the fact that in an experimental realization of ... the sequence alignment and drafted the manuscript GAF contributed in analysis of the numerical results All authors read and approved the final manuscript Competing interests The authors declare ... corresponding to the states that are indicated by arrows in panel (a) (a) (b) Figure Energy levels of a single kink profile in bilayer graphene as function of external magnetic field B0 with the same...

Ngày tải lên: 21/06/2014, 02:20