gene symbol gstk1 glutathione s transferase kappa 1

... 2 .15 Immunohistochemistry 70 2 .16 In silico analysis 71 2 .16 .1 Mass spectra analysis – ProteinPilot™ 71 2 .16 .2 Gene Ontology over-representation and pathway analysis ... proteomics 11 0 Figure 30 Bias analysis of protein attributes 11 1 Figure 31 Pie charts of GO slim analysis 11 2 Figure 32 Non-intersecting GO terms of proteins in and weeks ... Genotype Sod2-/- Strain CD1-tm1Cje† CD1-tm1Cje CD1-tm1Cje, B6D2F1tm1Cje* CD1-tm1Cje CD1-tm1Cje B6D2F1-tm1Cje (5 days old) B6D2F1-tm1Cje (15 days old) Organ Brain, heart Decreased ACO2 activity...

Ngày tải lên: 12/09/2015, 11:08

... FEBS 2002 Omega-class GST from Schistosoma mansoni (Eur J Biochem 269) 5 513 At least five GST activities have been described in the human parasite Schistosoma mansoni (SmGST -1 to SmGST-5) SmGST-5 ... methods [26] Southern blot analysis was performed using S mansoni cercariae purified DNA as described [26] Alignments and phylogenetic analysis of S mansoni GSTs Sm26GST, Sm28GST and SmGSTO amino ... results suggested that SmGSTO is expressed more in parasitic stages than in free living stages during the S mansoni life cycle Fig Southern blot analysis of SmGST DNA from S mansoni cercaria (10 ...

Ngày tải lên: 21/02/2014, 01:21

... tính GST (nmol CDNB/phút/mg protein) Não Cơ Mang 15 3,88 ± 79,27a 14 7,54 ± 51, 93a 13 6,23 ± 48,70a 14 4,66 ± 58 ,13 a 41, 71 ± 24,85a 32, 61 ± 18 ,31a 30,60 ± 20,58a 31, 42 ± 18 ,74a 11 1, 51 ± 51, 22a 10 6,80 ... (Oreochromis niloticus) Luận văn Thạc s Nuôi trồng thủy s n Đại học Cần Thơ Edwards, C.A., Fisher, S. W., 19 91 The use of cholinesterase measurement in assessing the impact of pesticides on terrestial ... 10 6,80 ± 60,50a 10 0,08 ± 41, 14a 94 ,15 ± 44,31a 12 1,57 ± 54,86a 14 2,77 ± 69,79a 15 2,02 ± 43,34a 15 8,49 ± 71, 95a 14 5,88 ± 65,78a 15 4,70 ± 65,96a 12 7,67 ± 46,32a 36,57 ± 13 ,65a 37 ,15 ± 16 ,18 a 36,97 ±...

Ngày tải lên: 11/03/2014, 05:21

... AgGSTD3 BmGST1 MsGSTolf1 AgGSTD7 AgGSTS1 Bla g DmGSTS1 AF448500 L2 312 6 AF273039 AB1766 91 AF133268 AF0 711 61 AF 513 639 U92 412 NM _16 6 217 MsGST2 AgGSTE2 AgGSTE1 AgGSTO1 AgGSTT1 AgGSTZ1 L32092 AF 316 636 ... GST compared with those of other insect GSTs Values are the means ± SE from three separate experiments Substrate specificities of Delta class GSTs from D melanogaster D1 [22], N lugens 1 1 [17 ] ... (20 01) The crystal structures of glutathione S- transferases isozymes 1- 3 and 1- 4 from Anopheles dirus species B Protein Sci 10 , 217 6– 218 5 30 Karplus M & Kruiyan J (2005) Molecular dynamics and...

Ngày tải lên: 23/03/2014, 09:21

... mGSTA4-4 [14 ], Drosophila melanogaster DmGSTD1 -1 [17 ], hGSTA1 -1 [18 ] and hGSTP1 -1 [19 ] have been described previously Preparation of hGSTA4-4 eukaryotic expression constructs The hGSTA4 ORF was amplified ... activation [34] We show that neither hGSTP1 -1 nor hGSTA1 -1 cause transformation but mouse and Drosophila 4-HNE-metabolizing GST isozymes (mGSTA4-4 and DmGSTD1 -1, respectively) show transforming activity ... changes in the homeostasis of 4-HNE and its metabolites that provides the mechanistic basis for the transformation This possibility needs to be explored in future studies Our results show that some...

Ngày tải lên: 30/03/2014, 13:20

... decussatus GST isoforms Results are expressed as means ± SD Reverse phase HPLC retention time (Rt) of subunits expressed in minutes; apparent molecular mass of each subunit expressed in kDa (see ... alpha, pi GST classes consensus sequences of mammals are from Fitzpatrick et al [28] Species GST 44 GSH binding protein GST GST Consensus mu Consensus alpha Consensus pi N-terminal sequence Identity ... as substrates Results are expressed as means ± SD Constant GST 3-3 Vmax (CDNB) (lmolÆmin )1 mg )1) Vmax (GSH) (lmolÆmin )1 mg )1) Km (CDNB) (mM) Km (GSH) (mM) kcat (s) 1) kcat/Km (CDNB) (mM )1 s) 1) ...

Ngày tải lên: 31/03/2014, 09:20

... GFP–CDS CDS CDS CDS CDS CDS CDS CDS CDS CDS CDS STOP 3¢-UTR 3¢-UTR 3¢-UTR 3¢-UTR – – 36–55 11 9 13 8 15 2 17 1 17 5 19 4 – 326–345 397–426 480–499 524–543 – – 786–805 – – 978–997 – – – 11 9 13 8 15 2 17 1 17 5 19 4 ... others (i.e AS-5, AS -10 , AS -11 , AS -13 and AS -14 ) were designed to inhibit selectively GSTM2 expression A third group of ODNs (i.e AS-2, AS-3, AS-4 and AS-9) was directed against homologous regions ... Regionb GSTM1 GSTM2 Mismatch c (number of bases) AS-ctrl AS-GFP AS -1 AS-2 AS-3 AS-4 AS-5 AS-6 AS-7 AS-8 AS-9 AS -10 AS -11 AS -12 AS -13 AS -14 AS -15 TGAGAGCTGAAAGCAGGTCCAT G*A*GCTGCACGCTGCCG*T*C GGCGGATCGGGTGTGTCAGC...

Ngày tải lên: 31/03/2014, 15:20

... proteins Statistical analysis Results were expressed as the mean ± standard error of the mean of eight specimens, and assays were performed in three independent experiments Statistical analysis was ... apoptotic response of chondrocytes to HNE is associated with decreased Bcl-2 expression and increased Bax expression This suggests that chondrocytes need to modulate the synthesis of at least several ... previous studies [16 ,17 ] To assess the functional consequences of GSTA4-4 inhibition versus overexpression in chondrocytes, the cytotoxicity of 30 μM HNE was evaluated by MTT cytotoxicity assay First,...

Ngày tải lên: 09/08/2014, 13:21

... Glu208Lys (K208E) 0. 012 5 rs 115 09438 C _11 309432_20 GSTO1 Exon6 A®C 0.0000 rs15032 C _11 7 418 5_80 GSTO2 Exon2 5’UTR ( -18 3) A®G Thr 217 Asn (T 217 N) — 0.2032 rs2297235 C _322 314 2 _1_ GSTO2 Exon5 A®G Asn142Asp ... polymorphisms (SNPs) genotyping was performed The association of GSTM1, GSTT1, GSTP1, GSTO1 and GSTO2 with UC risk was examined In addition, the joint effect of such genes with levels of arsenic exposure ... 70 10 ref 0. 61 110 14 0.90(0.40-2.03) 76 ref 0 .11 10 4 19 3.25 (1. 20-8.80)* P value GSTM1 Non-null Null GSTT1 16 5 ref 211 0.69(0 .17 -2. 81) Non-null 19 4 ref Null 18 0 0.27(0.05 -1. 37) 0.79 0.02 GSTP1 -10 5...

Ngày tải lên: 10/08/2014, 05:21

... shown) Western blot analysis for GSTO1 -1 showed decreased levels of GSTO 11 in the supernatants of COPD patients compared to nonsmokers (p = 0.023) (Figure 5A) These results suggest that GSTO1 -1 ... moderate/intense in 8 /16 non-smokers, 9/22 Statistical methods The statistical analyses were performed with the SPSS for Windows software (SPSS, Chicago, IL, USA) Continuous data were compared using analysis ... %pred Smoker N = COPD N = 15 p-value 59 (3) 4:2 10 7 (6) 83 (5) 99 (12 ) 96 (10 ) 10 1 (12 ) 52 (6) 4 :1 28 (11 ) 10 2 (15 ) 82 (5) 10 3 (12 ) 84 (13 ) 10 2 (6) 63 (8) 8:7 47 (12 ) 62 (18 ) 64 (10 ) 31 (19 ) 65 (12 )...

Ngày tải lên: 12/08/2014, 15:20

... these risk factor assignments with outcomes were examined using similar regression techniques Gene- gene (GSTM1-SE) and gene- environment (GSTM1-smoking and SE-smoking) interactions were assessed ... the GST Mu1 (GSTM1) locus (GSTM1-null) [11 ] located on chromosome (1p13 .1) The GSTM1-null genotype has been associated with an increased risk of RA and in most [12 -14 ] but not all [15 ] case control ... Medical Research, 350 Community Drive, Manhasset, NY 11 030, USA Page of 10 10 11 12 13 14 15 Authors’ contributions TRM was involved in all aspects of study conception, design, analysis, interpretation...

Ngày tải lên: 12/08/2014, 15:22

... -1. 6 -4.5, 1. 3 0.28 19 20 455 3.4 -1. 5, 8.3 0 .18 GSTM1 non-null GSTM1 null 11 49 13 06 0.5 -1. 2, 2.2 0.54 11 31 1284 1. 1 -1. 2, 3.4 0.36 11 15 12 60 -0.8 -4.7, 3 .1 0.69 GSTP1 10 5 Ile/Ile GSTP1 ... 0.48 11 26 10 30 219 -3.0 0.5 -7.0, 1. 1 -6.5, 7.5 0 .15 0.88 GSTM1T1 both non-null GSTM1T1 either null GSTM1T1 both null GSTT1*GSTM1Interaction Sex* Genotype Interaction†† sex*GSTT1 sex*GSTM1 sex*GSTP1 ... 95%CI p-value § 18 53 378 -5.3 -8.4, -2 .1 0.0 01 ** 18 06 3 71 -5.2 -7.4, -1. 3 0 .17 17 87 366 -5.0 -11 .7, 1. 8 0 .15 GSTM1 non-null GSTM1 null 10 60 11 71 -2 .1 -4.5, 0.3 0.0 81 1040 11 37 -0.8 -4.0,...

Ngày tải lên: 12/08/2014, 16:20

... cancer 18 1. 6 .1 Resisting intrinsic pressures for apoptosis 23 1. 6.2 Resisting extrinsic pressures for apoptosis 25 1. 6.3 Chemotherapy resistance 27 1. 7 Glutathione S- transferase pi (GST-pi) 30 1. 8 ... analysis 49 2 .10 Statistical analysis 50 RESULTS 51 3 .1 Glutathione S- transferase pi (GST-pi) expression 52 3.2 Total glutathione S- transferase (GST) activity 55 v 3.3 Bcl-2 expression 59 3.4 Association ... 3 .15 .3 YB -1 1 01 3 .15 .4 MT 10 2 3 .15 .5 Multivariate analysis 3 .16 10 0 10 4 Adjuvant chemotherapy and recurrence 10 5 3 .16 .1 GST-pi 10 7 3 .16 .2 Bcl-2 10 7 3 .16 .3 YB -1 110 3 .16 .4 Pgp 11 3 vi 3 .16 .5 MT 11 4...

Ngày tải lên: 16/09/2015, 17:14

... increase in response to a wide variety of stressful conditions, such as herbicides [1, 11] , chilling [11 ,12 ], hypoxic stress [13 ], dehydration [14 ], wounding [15 ], and pathogen attack [16 ,17 ] Most ... GSTU2 This assumption is also supported by the analysis of gene expression, which showed that the GSTU1 gene is induced by cadmium sulfate, CDNB, cyhalothrin, and cold stress, whereas GSTU2 is ... recombinant sweet orange GST subunits (Fig 1) CDNB is generally considered to be the classic GST substrate, because most GST isoenzymes display high activity towards it It has been shown that the sweet...

Ngày tải lên: 15/03/2014, 09:20

... was one predominant transcription start site and several other transcription start sites in the mouse CB1 gene that were used to express the CB1 gene in striatal and cortical neurons We consistently ... Density 60 50 40 * 30 * * ~ * ~ 20 * * ~ * ~ ** * * 10 11 * * * ~ 10 * * * ~ 12 15 18 * * 21 24 Age (weeks) C Log(Optical Density) Optical Density 50 40 30 20 10 1. 8 1. 6 1. 4 1. 2 1. 0 0.8 0.6 0 10 ... K., Hansen, A.K., Hasholt, L & Sorensen, S. A (2003) Molecular and behavioral analysis of the R6 /1 Huntington s disease transgenic mouse Neuroscience 12 2, 10 49 10 57 12 Hebb, A.L.O., Robertson, H.A...

Ngày tải lên: 16/03/2014, 18:20

... turtles the turtle liver GSTs are consistent with their classification as a class enzymes Responses to inhibitors also generally supported this conclusion Cibacron Blue causes greatest to least inhibition ... mass of some yeast (Y lipolytica) GSTs, however, is 11 0 kDa [32] Thus GSTs can vary widely in their subunit size The larger molecular mass of turtle GSTs may arise as a result of post-translational ... of the cytosolic glutathione S- transferases from two salmonid species: Atlantic salmon (Salmo salar) and brown trout (Salmo trutta) Comp Biochem Physiol C 13 1, 207– 213 Singhal SS, Saxena M, Ahmad...

Ngày tải lên: 23/03/2014, 15:20

... participate in the biosynthesis of esters [9 ,16 ], and defence compounds [17 ,18 ] This acyl -transferase gene family is very large In Arabidopsis for instance, it is composed of 90 members that underwent ... acyl -transferase family (Fig 2) show three groups of protein sequences The first group comprises the two yeast AATs, ATF1 and ATF2 The second is composed of three proteins characterized as O-transferases, ... and CM-AAT2 gene expression RT-PCR studies indicated that both genes are specifically expressed in fruit Vegetative tissues such as leaves, stems and roots exhibited no expression even when treated...

Ngày tải lên: 31/03/2014, 21:21

... http://arthritis-research.com/content/7/6/R1289 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Eekhoff EW, Karperien M, Houtsma D, Zwinderman AH, Dragoiescu C, Kneppers AL, Papapoulos SE: Familial Paget 's disease ... Domain-specific mutations in sequestosome (SQSTM1) cause familial and sporadic Paget 's disease Hum Mol Genet 2002, 11 :735-739 Johnson-Pais TL, Wisdom JH, Weldon KS, Cody JD, Hansen MF, Singer FR, Leach ... novel mutations at exon of Sequestosome gene (SQSTM1) in an Italian series of patients affected by Paget 's disease of bone (PDB) J Bone Miner Res 2004, 19 :10 13 -10 17 Geetha T, Wooten MW: Structure...

Ngày tải lên: 09/08/2014, 07:20

... autoantibodies, in whom disease is usually less systemic Moreover, we previously reported that BAFF level was not associated with systemic features in pSS [8] Likewise, no association was found between ... over-expression in pSS deserves further investigation Finally, our study clearly demonstrates that BAFF gene polymorphism is neither involved in genetic predisposition to pSS nor associated with a specific ... patients with pSS The bar represents the standard error BAFF = B-cell-activating factor; pSS, primary Sjögren 's syndrome Discussion level in 95 patients with pSS Association between BAFF -8 71 T/C...

Ngày tải lên: 09/08/2014, 07:20

... to associate with COPD in many previous investigations GSTP1 gene polymorphism correlates with susceptibility to COPD [13 ] and homozygous deletion of the GSTM1 gene is associated with emphysema ... supernatants These results can be related to many reasons one of those being proteolysis of GST alpha in the tissues Another, even more likely reason is the presence of various alphaclass GSTs in human ... glutathione S- transferases of rabbit lung and liver Primary sequences, expression, and regulation J Biol Chem 19 91, 266 :19 6 81- 19687 Hayes JD, Flanagan JU, Jowsey IR: Glutathione transferases Annu...

Ngày tải lên: 12/08/2014, 14:20