gene environment interactions as a challenge for biobanks

Single nucleotide polymorphism rs13042395 in the SLC52A3 gene as a biomarker for regional lymph node metastasis and relapse-free survival of esophageal squamous cell carcinoma patients

Single nucleotide polymorphism rs13042395 in the SLC52A3 gene as a biomarker for regional lymph node metastasis and relapse-free survival of esophageal squamous cell carcinoma patients

... invasion (T), regional lymph node metastasis (N) and distant metastasis (M) There were collinearities between TNM stage and tumor invasion, regional lymph node metastasis and distant metastasis, ... more information about the relation between tumor invasion, regional lymph node metastasis, distant metastasis and survival, we excluded TNM stage, in the multivariate Cox analysis, by a forward ... Cancer (2016) 16:560 Page of 11 Table Univariate analyses and multivariate analysis of factors associated with relapse-free survival for ESCC patients (NESCC = 288) Table Univariate analyses and

Ngày tải lên: 20/09/2020, 15:05

11 18 0
Expression of astrocyte elevated gene-1 (AEG-1) as a biomarker for aggressive pancreatic ductal adenocarcinoma

Expression of astrocyte elevated gene-1 (AEG-1) as a biomarker for aggressive pancreatic ductal adenocarcinoma

... cell carcinoma, prostate cancer, and hepatocellular carcinoma [9-15] As a downstream target of Ha-Ras, AEG-1 plays an essential role in promoting tumorigenesis, invasion, metastasis, and angiogenesis ... VA) AsPC-1 was originally isolated from ascites of a patient with a Grade PDAC, while Mia Paca-2 and Panc-1 were from patients with poorly-differentiated (G3) primary PDAC, Capan-1 was isolated ... from a lymph node metastasis of a PDAC patients, BxPC-3 was isolated from a patient with pancreas ductal carcinoma in situ In contrast, HPDE6 was isolated from normal epithelial tissue of pancreatic

Ngày tải lên: 14/10/2020, 17:29

10 15 0
An evaluation of interactions access reading used as a textbook for efl college students at ca mau community college

An evaluation of interactions access reading used as a textbook for efl college students at ca mau community college

... The research was conducted in two stages: a theoretical evaluation and an empirical evaluation The theoretical evaluation was based on the researcher’s experience, expertise, and the literature ... TABLES Table 4.1: Summary of teachers’ evaluation on practical considerations, physical appearance and content pages 31 Table 4.2: Summary of teachers’ evaluation of organization and ... teaching and learning this textbook Also, if the researcher had a chance to a research on the pack of textbooks (Interactions Access Reading, Interactions Reading and Interactions Reading) taught

Ngày tải lên: 25/08/2021, 16:35

78 20 0
AN EVALUATION OF “INTERACTIONS ACCESS READING” USED AS a TEXTBOOK FOR EFL COLLEGE STUDENTS AT CA MAU COMMUNITY COLLEGE

AN EVALUATION OF “INTERACTIONS ACCESS READING” USED AS a TEXTBOOK FOR EFL COLLEGE STUDENTS AT CA MAU COMMUNITY COLLEGE

... Interactions Access Reading – Silver Edition for Ca Mau Community College The research was conducted in two stages: a theoretical evaluation and an empirical evaluation The theoretical evaluation was based ... research site, participants, data types and methods of data collection, and analytical framework Chapter analyses and discusses the findings grounded in the data analyzed in the previous chapter ... recording enables researchers to see what happens in the classrooms in detail, thereby making classroom observation data more reliable Last but not least, the future research should make a consideration

Ngày tải lên: 09/03/2022, 19:08

95 19 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

... 32] ISS hnRNP A1 UAGUGAAUAGAGUUAGGCAGGGA 7928–7950 ESE3 ASF ⁄ SF2 GAAGAAGAA 8016–8025 hnRNP A1 UAGAAGAAGAA 8018–8025 HIV-1 alternative splicing regulation J. Tazi et al. 872 FEBS Journal 277 (2010) ... 5428–5437 ESE2 SC35, SRp40 CCAGUAGAUCCUAGACUAGA 5418–5437 A5 ESE GAR ASF ⁄ SF2, SRp40 GAAGAAGCGGAGACAGCGACGAAGA 5558–5582 [7] A7 ESS3 hnRNP A1 , hnRNP E1 ⁄ E2 AGAUCCAUUCGAUUAG unknown 8047–8062 [43, ... MINIREVIEW Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action Jamal Tazi 1 , Nadia Bakkour 1 , Virginie Marchand 2 , Lilia Ayadi 2 , Amina Aboufirassi 1 and Christiane Branlant 2 1

Ngày tải lên: 06/03/2014, 09:22

10 434 0
Milk Diet As A Remedy For Chronic Disease- p1 potx

Milk Diet As A Remedy For Chronic Disease- p1 potx

... size, it has a decided advantage in ease of absorption. “This breed can be traced back for 2,000 years and was always famous for dairy purposes. In temperament, these animals are quiet and docile, ... head bent forward at an unnatural angle to keep it out of the water Breathe deeply, and occasionally... was acquainted with a Mr Castel, of Chicago, who was in the same condition, from the same ... continue at least 36 hours, but the patient is allowed to eat ripe fresh and dried fruits (except bananas) in such quantities as may be eaten with a relish, and as much water may be taken as

Ngày tải lên: 15/03/2014, 00:20

101 454 0
Báo cáo khoa học: Nature, nurture and neurology: gene–environment interactions in neurodegenerative disease docx

Báo cáo khoa học: Nature, nurture and neurology: gene–environment interactions in neurodegenerative disease docx

... Warsaw Tara L. Spires 1 and Anthony J. Hannan 2 1 MassGeneral Institute for Neurodegenerative Disease, Massachusetts General Hospital and Harvard Medical School, Charlestown, MA, USA 2 Howard Florey ... was suppor- ted by NIH grant NIA 5 T32 AG00277 and an Alzhei- mer Association pioneer award, and the Australian National Health and Medical Research Council. AJH would like to thank C. Hannan ... ageing and associated cognitive Table 2. Environmental influences on neurodegenerative disease. AD, Alzheimer’s disease; HD, Huntington’s disease; PD, Parkinson’s dis- ease. Disease Environmental factor

Ngày tải lên: 16/03/2014, 19:20

15 505 0
Báo cáo Y học: The S100A8/A9 protein as a partner for the cytosolic factors of NADPH oxidase activation in neutrophils doc

Báo cáo Y học: The S100A8/A9 protein as a partner for the cytosolic factors of NADPH oxidase activation in neutrophils doc

... contaminant [15]. The identity of S10 0A8 was further ascertained by amino-acid sequencing, using Edman degra- dation. As S10 0A9 has a blocked N-terminal amino acid, analysis of the protein was carried ... dismutase. NADPH oxidase activity was also assayed by polarographic meas- urement of the rate of O 2 uptake at 20 °CwithaClark electrode at a voltage of 0.8 V. All experiments were carried out at least ... Amersham. Protein concentration was assayed with the bicinchonic acid reagent (BCA) (Bio-Rad) using bovine serum albumin as standard. Arachidonic acid was dissolved in ethanol and stored as a stock

Ngày tải lên: 18/03/2014, 01:20

10 396 0
Báo cáo khoa học: Hematopoietic differentiation from human ESCs as a model for developmental studies and future clinical translations Invited review following the FEBS Anniversary Prize received on 5 July 2009 at the 34th FEBS Congress in Prague docx

Báo cáo khoa học: Hematopoietic differentiation from human ESCs as a model for developmental studies and future clinical translations Invited review following the FEBS Anniversary Prize received on 5 July 2009 at the 34th FEBS Congress in Prague docx

... Nature 460, 909–913 89 Hong H, Takahashi K, Ichisaka T, Aoi T, Kanagawa O, Nakagawa M, Okita K & Yamanaka S (2009) Suppression of induced pluripotent stem cell generation by the p53–p21 pathway ... cell anemia carrying the human mutant variant of the b-globin gene (bS) that is responsible for the disease Fibroblasts from a diseased animal were reprogrammed into iPSCs, and the sickle cell anemia ... therapy based on reconstitution of the leukocytic hematopoietic compartment using a CD34+ hESC-derived starting population has been considered as a potential AIDS therapy, and as a way to alleviate

Ngày tải lên: 22/03/2014, 17:20

12 550 0
Báo cáo khoa học: Hyaluronan–CD44 interactions as potential targets for cancer therapy pptx

Báo cáo khoa học: Hyaluronan–CD44 interactions as potential targets for cancer therapy pptx

... overproduction of HA in cancer cells, such as fibrosarcomas, breast cancer, mesotheliomas and prostate cancer, transfected with HAS1, HAS2 and HAS3 genes, triggered intracellular signaling pathways that promoted ... in breast, cervical and colon cancers, and in squamous cell carcinomas Thus CD44v was chosen as a model for therapy A Phase clinical trial was performed with an immunotoxin (humanized antibody ... Hyaluronan–CD44 interactions as potential targets for cancer therapy Suniti Misra1, Paraskevi Heldin2, Vincent C Hascall3, Nikos K Karamanos4, Spyros S Skandalis2, Roger R Markwald1 and Shibnath

Ngày tải lên: 28/03/2014, 23:20

15 458 0
Báo cáo khoa học nông nghiệp " Nutrient recovery by rice crops as a treatment for aquaculture solid waste: crop yield, nutrient status and nutrient budgets " doc

Báo cáo khoa học nông nghiệp " Nutrient recovery by rice crops as a treatment for aquaculture solid waste: crop yield, nutrient status and nutrient budgets " doc

... cv. Thai Bonet was used for both wet and dry season crops. All fishpond solid waste was applied before planting as was 50 % of the inorganic P and K. The remaining P and K was applied at panicle ... followed standard methods for soil (Page et al. 1982), plant analysis (Chapman and Pratt, 1961); water and wastes samples analysis followed methods for chemical analysis of water and wastes (MCAWW) ... size fractionation and characterisation of an aquacultural effluent Aquaculture 133, 323-339 Falahi-Ardakani,... rice paddy area Greater than 60 ha per ha of fishpond area would be advisable

Ngày tải lên: 21/06/2014, 04:20

24 346 0
Báo cáo y học: " A model of gene-gene and gene-environment interactions and its implications for targeting environmental " doc

Báo cáo y học: " A model of gene-gene and gene-environment interactions and its implications for targeting environmental " doc

... Mrelge may be written as: Additional File Gene- gene and gene- environment interaction model Contains the Visual Basic macro (Twincal), input and output datasheets and charts used to calculate the ... variance (based on the values used for breast cancer), and high environmental variance (based on the values used for smoking and lung cancer) Detailed results for the three diseases are shown in [Additional ... These alternative models imply that shared environmental factors may partially explain familial aggregation of breast cancer This contrasts with the classical twin method result (see earlier),...

Ngày tải lên: 13/08/2014, 16:21

24 603 0
Báo cáo y học: "Genetic polymorphisms in PTPN22, PADI-4, and CTLA-4 and risk for rheumatoid arthritis in two longitudinal cohort studies: evidence of gene-environment interactions with heavy cigarette smoking" potx

Báo cáo y học: "Genetic polymorphisms in PTPN22, PADI-4, and CTLA-4 and risk for rheumatoid arthritis in two longitudinal cohort studies: evidence of gene-environment interactions with heavy cigarette smoking" potx

... Sawada T, Suzuki M, Nagasaki M, Nakayama-Hamada M, Kawaida R, Ono M, Ohtsuki M, Furukawa H, Yoshino S, Yukioka M, Tohma S, Matsubara T, Wakitani S, Teshima R, Nishioka Y, Sekine A, Iida A, Takahashi ... statistical analysis S-CC was responsible for analysis and interpretation of data, manuscript preparation, and statistical analysis IDV was responsible for analysis and interpretation of data, manuscript ... supplies (a small bottle of mouthwash, a plastic cup with a screwtop cap, a ziplock plastic bag and absorbent sheet, and a stamped, self-addressed bubble envelope), as well as an informed consent form...

Ngày tải lên: 09/08/2014, 10:23

12 336 0
Epigenetic control of neuronal activity dependent gene transcription as a basis for long term memory formation

Epigenetic control of neuronal activity dependent gene transcription as a basis for long term memory formation

... when I was first trying to walk (aka run gels), Rajaram Ezhilarasan for the hard work and dedication, Niamh Higgins, Knvul Sheikh, Annabel Tan, Gokul Banumurthy our amazing RA’s who work day and ... One particular epigenetic regulator, the HAT enzyme TIP60 (HIV Tat interactive Protein, 60 kDa, also known as KAT5), has emerged as an important effector of neuronal plasticity and memory formation76 ... 113 Alternatively for ChIP- RT-PCR analyses, immunoprecipitated chromatin was eluted, reversecrosslinked, and treated with RNAse A for hour at 37°C and Proteinase K for hours at 62°C DNA was purified...

Ngày tải lên: 09/09/2015, 08:13

150 431 0
Dirty industry migration and the environment   china as a major case for study

Dirty industry migration and the environment china as a major case for study

... classical theories of comparative advantage It regards the environmental standard of a country as an important factor which shapes the country’s comparative advantage in international trade and ... removal of trade barriers such as tariffs, regulations, certain standards, legislation and regulatory measures, as well as removal of restrictions on capital flows and investments play a crucial ... research on China as a major case for study Making China the country for study has its value China is among the few developing countries that have maintained a rapid economic progress in the last...

Ngày tải lên: 14/09/2015, 18:30

412 904 0
Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly

Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly

... samples was created by a laboratory panel (n ¼ 9; females, males, aged 25 –41 years) trained to evaluate attributes selected in advance The attributes were evaluated on a 9-point scale that was ... Preliminary data analysis revealed no significant main effects and only one significant interaction of day and aroma on the pleasantness ratings of the young, implicating an increase in pleasantness ... Hedonic ratings In the pleasantness ratings, the aroma concentration had a similar effect on both age groups in the first tasting session: the heightened aroma sample was rated as less pleasant than...

Ngày tải lên: 03/04/2013, 21:06

10 599 1
Module 7: Microsoft Proxy Server 2.0 as a Solution for Internet Connectivity

Module 7: Microsoft Proxy Server 2.0 as a Solution for Internet Connectivity

... Network Load Balancing provides a greater benefit than round robin DNS entries because Network Load Balancing automatically excludes servers that are unavailable You can enhance the availability for ... Server as LAN interfaces are persistent, and the data rate is determined by the LAN technology Public network segments that appear as demand-dial interfaces are nonpersistent, and the data rate ... servers make up a proxy array called proxyarray.msft Each of the servers in the array has a unique IP address, so you need to specify an A- type resource record for each server as follows: proxyarray.msft...

Ngày tải lên: 18/10/2013, 18:15

62 359 0
Module 8: Routing as a Solution for Private Network Connectivity

Module 8: Routing as a Solution for Private Network Connectivity

... of applications that can take advantage of multicast transmissions RIP -for- IP version is an example of a protocol that can take advantage of multicast transmissions to update routing information ... information for unicast packets Unlike RIP -for- IP routers, OSPF routers maintain a map of the network in the link state database Updates to the network are reflected in the link state database ... subnets and hosts can be easily managed by RIP -for- IP version Specify auto-static routing with updates once a day at midnight To automatically update the routing information at a regular interval...

Ngày tải lên: 18/10/2013, 18:15

50 371 0
Module 10: RADIUS as a Solution for Remote Access

Module 10: RADIUS as a Solution for Remote Access

... engineers use a Web-based application for maintenance tracking and reporting Customers can place maintenance requests by using another Webbased application that either creates a maintenance request ... certificates Note As a best practice, specify RADIUS secrets that are at least 16 characters in length and that include upper case letters, lowercase letters, and punctuation 26 Module 10: RADIUS as ... Enhancing a RADIUS Design for Availability Optimizing a RADIUS Design for Performance Discussion: Enhancing the RADIUS Solution An organization has a geographically distributed work force that...

Ngày tải lên: 22/10/2013, 16:15

50 442 0
Social factors as a basis for treatment

Social factors as a basis for treatment

... increased demand for inpatient psychiatric care (Abas et al., 2003), and, while poverty and substance abuse are not necessarily related, poverty often increases the degree of harm that occurs at any ... frequency of hospitalisation (McGurk and Mueser, 2003; Sengupta et al., 1998) 167 Social factors as a basis for treatment Integration of vocational rehabilitation and mental health services Supported ... each year In 1976, Fountain House launched a national training programme and in 1988, a national expansion effort The International Center for Clubhouse Development was established in 1994, launching...

Ngày tải lên: 01/11/2013, 09:20

16 524 0
w