galton watson processes in a random environment and macroevolution

Tài liệu Debugging C and C++ code in a Unix environment ppt

Tài liệu Debugging C and C++ code in a Unix environment ppt

... cafetaria and some serious caffeine and sugar intake while reading (and annotating) your code carefully Tools In this section a number of tools relating to debugging and analysing your programs ... if you are interested in it Chapter Aspects of debugging C and C++ code Debugging C and C++ code entails noticing, localising, understanding and repairing bugs Noticing and localising a bug You ... assert macro, your program will be aborted as soon as an assertion fails, and you will get a message stating that the assertion expression failed at line l of file f assert is a macro; you can...

Ngày tải lên: 21/01/2014, 06:20

29 466 1
Intellectual Property and Traditional Cultural Expressions in a Digital Environment pptx

Intellectual Property and Traditional Cultural Expressions in a Digital Environment pptx

... Intelligent Analysis and Information Systems in Germany, an International Fellow of the Yale Law School Information Society Project and has been an International Scholar at the Information Law and Policy ... behind relying on national patent law is revealed by the Ayahuasca Liana case, where da Vine was only patentable because of its slightly modified petal and leaf shape But also approaches relying ... Press, 2004, at p 107 25 Beatriz Caiuby Labate and Wladimyr Sena Araujo, O Uso Ritual da Ayahuasca, Campinas: Mercado de Letras, 2004; Carsten Balzer, Wege zum Heil: Die Barquinha Eine ethnologische...

Ngày tải lên: 07/03/2014, 11:20

344 642 1
Báo cáo " Community based coastal resources management behind changes in surface water environment and land policy: A case study in the Tam Giang Lagoon, Central Vietnam " ppt

Báo cáo " Community based coastal resources management behind changes in surface water environment and land policy: A case study in the Tam Giang Lagoon, Central Vietnam " ppt

... management is a process of governance and political decision-making, geared toward the formation of partnerships and power sharing It is consensus-driven and geared toward achieving a balance of interests ... changes in historical lagoon’s utilization and management We used software tools such as Mapinfo 8.5 and Excel in order to modify maps and reckon the surveyed data And we also used the comparative ... multi-purposes, the total nitrogen (TN) level in several areas of the lagoon is higher than international standards [6, p.20] According to American standard, total nitrogen (TN) applied to coastal water (TN...

Ngày tải lên: 14/03/2014, 15:20

11 530 0
Protecting Children''''s Health In A Changing Environment - Report Of The Fifth Ministerial Conference On Environment And Health.pdf potx

Protecting Children''''s Health In A Changing Environment - Report Of The Fifth Ministerial Conference On Environment And Health.pdf potx

... implementation; • scaling up existing financial mechanisms; • bringing in new and innovative sources of finance; and • building capacities to secure, absorb and deploy environmental financing The ... Protecting children’s health in a changing environment Annex  arma Declaration on Environment P and Health and commitment to act Parma Declaration on Environment and Health We the Ministers and ... Ministerial Conference A range of environmental risk factors threatens health: inadequate water and sanitation, unsafe home and recreational environments, lack of spatial planning for physical...

Ngày tải lên: 22/03/2014, 16:22

92 501 0
Arctic Alpine Ecosystems and People in a Changing Environment pdf

Arctic Alpine Ecosystems and People in a Changing Environment pdf

... central Arctic have warmed by 0.5°C), temperatures in Canada’s Hudson Bay and in Greenland, particularly in the Davis Strait area have decreased (Chapman and Walsh 1993), suggesting that climate ... northern Canada; the Kalaallit and Inughuit of Greenland; the Saami of Fennoscandia and Russia’s Kola peninsula; and the Chukchi, Even, Evenk, Nenets, Nivkhi and Yukaghir of the Russian Far North and ... UV-radiation and the long-range transported contaminants in arctic and alpine regions are stress factors that challenge terrestrial and aquatic ecosystems The large natural variation in the physical parameters...

Ngày tải lên: 23/03/2014, 01:20

446 451 0
Báo cáo khoa học: HIV-1 gp41 and gp160 are hyperthermostable proteins in a mesophilic environment ppt

Báo cáo khoa học: HIV-1 gp41 and gp160 are hyperthermostable proteins in a mesophilic environment ppt

... kb DNA fragment, containing the sequence encoding the ectodomain of gp41 of HIV isolate LAI (amino acids 537–669), was obtained by PCR amplification using, as template, a plasmid containing the ... 5¢-CTCTTTCATGACGCTGACGGTA CAGGCC-3¢; reverse primer: 5¢-CCGCTCGAGCTAATG GTGATGGTGATGGTGTGACCCTCCCCCTCCACT TGCCCATTTATCTAA-3¢ The start codon in the forward primer (in bold) is a naturally occurring ... urea, 500 mM NaCl, 10 mM imidazole, pH 8.0) and agitated at °C for 30 After filtration using a 0.45 lm cut-off filter, protein was loaded onto a ml Hi-Trap Chelating column (Amersham Pharmacia Biotech),...

Ngày tải lên: 30/03/2014, 13:20

14 375 0
Chapter 7 Create, Add, Delete, and Edit Data in a Disconnected Environment

Chapter 7 Create, Add, Delete, and Edit Data in a Disconnected Environment

... own DataSet (schema) 1 Create Dataset Add DataTable(s) Add DataColumn(s) to DataTable Define datatable schema Fill Data into DataTable(s) in DataSet 2 Add DataRow to DataTable Processing data in ... 3: Creating DataAdapter Objects What Is a DataAdapter Between Dataset/Datatable and Database Connect to Command and Connection Fill and Update Dataset/DataTable Disconect to Dataset/DataTable ... provides access to one row of data in a DataTable DataSet A DataTable's DataRow objects contain all the data in the DataTable Create DataTable DataColumn DataRow Table.NewRow method Can access DataRow...

Ngày tải lên: 13/05/2014, 12:19

50 383 0
Báo cáo hóa học: " Research Article Implementation of a Cooperative MAC Protocol: Performance and Challenges in a Real Environment" doc

Báo cáo hóa học: " Research Article Implementation of a Cooperative MAC Protocol: Performance and Challenges in a Real Environment" doc

... corresponding data packet, since such information is contained in the MAC header and is in many instances transmitted at a rate higher than what STAs can support Fortunately, since each data packet sometimes ... sustainable rates between STAs and STAd , between STAs and STAh , and between STAh and STAd , respectively 3.2.1 Data Plane Before the transmission of a packet, station STAs should access all ... establishment and maintenance of a special data structure called the cooperation table (a. k .a CoopTable) as shown in Figure 3, which contains essential information related to all the potential...

Ngày tải lên: 21/06/2014, 20:20

19 368 0
Báo cáo khoa học: " Vegetative development, primary and secondary growth of the shoot system of young Terminalia superba tropical trees, in a natural environment. I. Spatial variation" pot

Báo cáo khoa học: " Vegetative development, primary and secondary growth of the shoot system of young Terminalia superba tropical trees, in a natural environment. I. Spatial variation" pot

... irregular concentric bands on a comparatively dark background (figs 4A, B) These bands were paratracheal axial parenchyma of the confluent type In general, band spacing varied gradually, increasing ... displays annual growth rings (Lowe, 1968; Paliwal and Prasad, 1970; Lawton and Lawton, 1971; Rao, 1972; Amobi, 1973; Paliwal et al, 1976; Ghouse and Shamima Hashmi, 1979; Zamski, 1979; Rao and Dave, ... sympodial MATERIALS AND METHODS and unit is characteristic of the genus Terminalia, the Terminalia branching being specifically described in T catappa (Hallé and Oldeman, 1970; Tomlinson and Gill,...

Ngày tải lên: 08/08/2014, 23:22

14 434 0
Báo cáo khoa học: "Vegetative development, primary and secondary growth of the shoot system of young Terminalia superba tropical trees, in a natural environment. II. Terminal growth, lateral growth and main stem-branch growth correlations" ppsx

Báo cáo khoa học: "Vegetative development, primary and secondary growth of the shoot system of young Terminalia superba tropical trees, in a natural environment. II. Terminal growth, lateral growth and main stem-branch growth correlations" ppsx

... radial growth was increased during March and after, in the equivalent parts of main stems Growth of a For an tree T "decapitated" plant unknown reason, the main apex of died During February and ... 198 7a) Besides terminal growth, lateral growth is also described, ie the appearance of axillary shoots and dynamics of branching, as well as radial growth of both main stems and branches In addition, ... mature T catappa but according to other authors (Hallé and Oldeman, 1970 writing about T catappa; Maillard, 1987; Maillard et al, 1989 writing about young T superba grow- ing in a controlled glasshouse),...

Ngày tải lên: 08/08/2014, 23:22

20 448 0
The dynamics of literary representation and interpretation in a multilingual environment  a study of selected malaysian and singaporean novels in english

The dynamics of literary representation and interpretation in a multilingual environment a study of selected malaysian and singaporean novels in english

... in an article, “Trial and Error in Malayan Poetry”, Wang Gungwu admits that they “had promoted a didactic approach to poetry in Malaya” and that their “moral and political attidudes to Malaya ... Achenese, Javanese, Sulawesis and Minangkabaus from Sumatra They spoke different varieties of Malay Munshi Abdullah in his travel accounts contrasts the ‘pure Malay language’ (Andaya & Andaya 119) ... surprising that the main lingua franca among the non-English educated remained Bazaar Malay, while among the English educated, a new lingua franca, Singapore-Malayan English, developed “mainly...

Ngày tải lên: 16/09/2015, 08:30

249 440 0
Quantifying recent trends in seagrass cover and biomass in a stressed environment, pulau semakau, singapore

Quantifying recent trends in seagrass cover and biomass in a stressed environment, pulau semakau, singapore

... SWIR bands, all with 30 meter resolution The USGS Landsat-8 Operational Land Imager (OLI) has similar bands as Landsat-7, with two additional visible and NIR bands Both Landsat-7 and Landsat-8 also ... Singapore’s shallow, intertidal seagrass beds and seagrass beds globally are important in maintaining coastline stability and reducing turbidity Seagrass also provides a significant mechanism ... physiology make them invaluable to human and environmental health 1.1 Importance of seagrass Tropical seagrass meadows play important roles in maintaining the health of adjacent tropical ecosystems and...

Ngày tải lên: 30/09/2015, 10:12

124 328 0
Wireshark: Determining a SMB and NTLM version in a Windows environment

Wireshark: Determining a SMB and NTLM version in a Windows environment

... with default settings it will always use NTLMv1 If we use an Windows or Vista client and a windows 2008 R2 server it will use NTLMv2 Lets fire up Wireshark and take a look what’s happening “on ... an NTLM CHALLENGE_MESSAGE is embedded The message includes an 8-byte random number, called a “challenge”, that the server generates and sends in the ServerChallenge field of the message Step – ... for authentication and thus insecure We need to change this so the XP machines will authenticate by using NTLMv2 We can achieve this by change the Lmcompatibilitylevel value to The best way to achieve...

Ngày tải lên: 17/11/2015, 09:36

16 376 0
Báo cáo y học: "Strict glycaemic control in patients hospitalised in a mixed medical and surgical intensive care unit: a randomised clinical trial"

Báo cáo y học: "Strict glycaemic control in patients hospitalised in a mixed medical and surgical intensive care unit: a randomised clinical trial"

... data analysis and interpretation, and drafting of the manuscript, NS, MB, JT, JV, JV, CA, PA, EV, JCH, AY, WP and CC participated in the study design, data acquisition and drafting of the manuscript ... 250) in the standard insulin group and 36.6% (93 of 254) in the intensive insulin group ICU mortality was similar for patients of the standard insulin group and in those from the intensive insulin ... [1-4] A randomised trial of 1548 patients hospitalised in a surgical intensive care unit (ICU) showed that maintaining normal glucose levels reduces morbidity and mortality [5] In another randomised...

Ngày tải lên: 25/10/2012, 10:35

9 636 0
Analytical Chemistry in a GMP Environment: A Practical Guide pot

Analytical Chemistry in a GMP Environment: A Practical Guide pot

... SAMPLE HANDLING AND PREPARATION 11.1 Analytical tests may be required for a variety of reasons, including establishing an average analyte value across a material, establishing an analyte concentration ... LGC, UK; Bernard King, NARL, Australia; Alan Squirrell, NATA, Australia and Maire Walsh, State Laboratory, Ireland In addition, over the years leading to the drafting of this and earlier versions ... word-processing, database, spreadsheet, and data processing capabilities and can perform a variety of functions, including: sample registration and tracking; test assignment and allocation; worksheet...

Ngày tải lên: 15/03/2014, 16:20

57 685 1
BOREAL SHIELD WATERSHEDS Lake Trout Ecosystems in a Changing Environment ppt

BOREAL SHIELD WATERSHEDS Lake Trout Ecosystems in a Changing Environment ppt

... (Picea glauca), balsam fir (Abies balsamea), and eastern white pine (Pinus strobes) Throughout the area, warmer and drier sites are dominated by jack pine (Pinus banksiana) and red pine (Pinus resinosa); ... Resources Canada, Ottawa Ecological Stratification Working Group, 1995, A National Framework for Canada Cat No A4 2–65/1996E, Agriculture and Agri-Food Canada and Environment Canada, Ottawa Fulton, ... basin, and finally eastward into Lake Barlow-Ojibway (Mandrak and Crossman, 1992) Lake Barlow-Ojibway extended across northeastern Ontario and northwestern Quebec, and drained into the Ottawa...

Ngày tải lên: 23/03/2014, 01:20

528 479 0
Báo cáo khoa học: C-terminal truncated cannabinoid receptor 1 coexpressed with G protein trimer in Sf9 cells exists in a precoupled state and shows constitutive activity ppt

Báo cáo khoa học: C-terminal truncated cannabinoid receptor 1 coexpressed with G protein trimer in Sf9 cells exists in a precoupled state and shows constitutive activity ppt

... proteins increased GTPcS binding The cannabinoid receptor agonist WIN 55,212–2 (A) further increased GTPcS binding This binding was inhibited by the cannabinoid selective antagonist AM251 (IA) ... GTPcS binding assay (A) Specific increase in GTPcS binding to the Gi1 (r) protein and not the GsL (j) protein in the presence of membranes containing the truncated cannabinoid receptor Symbols s and ... nucleotide-binding protein Mol Pharmacol 43, 17–22 Rinaldi-Carmona M, Barth F, Heaulme M, Shire D, Calandra B, Congy C, Martinez S, Maruani J, Neliat G & Caput D (1994) SR14171 6A, a potent and selective...

Ngày tải lên: 23/03/2014, 07:20

10 313 0
Báo cáo khoa học: Cytochrome P460 of Nitrosomonas europaea Formation of the heme-lysine cross-link in a heterologous host and mutagenic conversion to a non-cross-linked cytochrome c ¢ pot

Báo cáo khoa học: Cytochrome P460 of Nitrosomonas europaea Formation of the heme-lysine cross-link in a heterologous host and mutagenic conversion to a non-cross-linked cytochrome c ¢ pot

... 5¢-AAATGCTTCAATGATAT CGAAAAAGGAAG-3¢, converted a unique SspI site on the vector to an EcoRV site The mutagenesis oligonucleotides were 5¢-GTAACTGTAAGAGAACTGGTCAC-3¢ (Lys70 to Arg), 5¢-GTAACTGTAGCAGAACTGGTCA ... hydrazine caused the Soret absorbance peak to initially shift to 438 nm and increase in intensity then greatly diminish over several minutes, while absorbance at 500 nm decreased and absorbance at ... crosslink in determining the Soret spectrum Although catalytic activity was lost in the mutants, the ligand-binding capability and thus the pentacoordinate nature of the heme was conserved Significantly,...

Ngày tải lên: 23/03/2014, 17:21

7 384 1
PROVIDING HIV/AIDS CARE IN A CHANGING ENVIRONMENT pdf

PROVIDING HIV/AIDS CARE IN A CHANGING ENVIRONMENT pdf

... within the past months, especially “family financial problems, parental abuse of alcohol, parental arguing and fighting, changing schools, serious accidents, and death in the family.”22 Because ... Health and Human Services Health Resources and Services Administration HIV/AIDS Bureau Editor Richard Seaton Impact Marketing and Communications All information herein is in the public domain ... counseling and testing HIV/AIDS stigma and fear of the lifethreatening implications of an HIV diagnosis—as well as a lack of awareness of “teen-friendly” testing facilities—may 0 The Family Advocacy...

Ngày tải lên: 28/03/2014, 14:20

8 369 0
Báo cáo khoa học: A structured RNA in hepatitis B virus post-transcriptional regulatory element represses alternative splicing in a sequence-independent and position-dependent manner pot

Báo cáo khoa học: A structured RNA in hepatitis B virus post-transcriptional regulatory element represses alternative splicing in a sequence-independent and position-dependent manner pot

... unspliced pgRNA and the SP1 splicing variant of HBV, primers SP1 (tgcccctatcctatcaacac), SP2 (actcccataggaattttccgaaa) and U2 (ttccaatgaggattaaagacag) were used Quantification of the splicing ratio by ... cleavage signal are present at the joint of some single-stranded and doublestranded regions, such as L1–S2 and S2–J1 ⁄ 2, suggesting that base pairing at these joint sites is dynamic (breathing) ... proteins, a family of proteins containing one or two RNA-binding domains and a signature RS domain rich in Arg ⁄ Ser dipeptides, and splicing silencers usually recruit heterogeneous nuclear RNPs, a set...

Ngày tải lên: 28/03/2014, 23:20

14 379 0
w