g il 12 p40 and tnf a mrna expression

Báo cáo y học: "Strong inhibition of TNF-α production and inhibition of IL-8 and COX-2 mRNA expression in monocyte-derived macrophages by RWJ 67657, a p38 mitogen-activated protein kinase (MAPK) inhibitor" ppt

Báo cáo y học: "Strong inhibition of TNF-α production and inhibition of IL-8 and COX-2 mRNA expression in monocyte-derived macrophages by RWJ 67657, a p38 mitogen-activated protein kinase (MAPK) inhibitor" ppt

Ngày tải lên : 09/08/2014, 01:23
... macrophages and peripheral blood mononuclear cells and has a broad substrate specificity and may contribute together with collagenases to the degradation of fibrillar collagens, basement membrane ... preliminary pharmacokinetic data suggest a twice-daily dosing regimen [15], while our data show significant effects at low concentrations Conclusion A significant inhibition of TNF- α production and mRNA ... was previously demonstrated that p38 MAPK plays a role in transcription and stabilization of COX-2 mRNA [23] However, Caivano and Cohen showed that both p38 MAPK and ERK influence COX-2 mRNA expression...
  • 9
  • 317
  • 0
báo cáo hóa học: " The impact of shift work induced chronic circadian disruption on IL-6 and TNF-a immune responses" pot

báo cáo hóa học: " The impact of shift work induced chronic circadian disruption on IL-6 and TNF-a immune responses" pot

Ngày tải lên : 20/06/2014, 00:20
... collection, data analysis and interpretation and took part in preparation of the manuscript DAG participated in data interpretation and took part in preparation of the manuscript MSpallek participated ... study coordination, data collection, data analysis and interpretation and in performing the statistical analysis and took part in preparation of the manuscript AO participated in the data collection, ... coordination, data analysis and interpretation and in performing the statistical analysis and took part in preparation of the manuscript KJC participated in the design of the study, data collection,...
  • 5
  • 505
  • 0
báo cáo khoa học: " Effects of ulinastatin and docataxel on breast tumor growth and expression of IL-6, IL-8, and TNF-a" doc

báo cáo khoa học: " Effects of ulinastatin and docataxel on breast tumor growth and expression of IL-6, IL-8, and TNF-a" doc

Ngày tải lên : 10/08/2014, 10:21
... 3’, TNF- a anti-sense: 5’ TCGGGGTTCGAGAAGATGAT 3’, b-actin sense: 5’ GCAGAAGGAGATCACAGCCCT 3’, and b-actin anti-sense:5’ GCTGATCCACATCTGCT GGAA 3’ The SYBR Green/ROX qPCR master mix was used with ... AAATTCGGTACATCCTCGAC 3’, IL- 6 anti-sense: 5’ CCTCTTTGCTGCTTTCACAC 3’, IL- 8 sense: 5’ TACTCCAAACCTTTCCACCC 3’, IL- 8 anti-sense: 5’ AAAACTTCTCCACAACCCTC 3’, TNF- a sense: 5’ GCCTGCTGCACTTTGGAGTG 3’, TNF- a ... UTI+TAX group (Table 2) 2.3 Expression of IL- 6, IL- 8, and TNF- a mRNA in MDA-MB-231 Treatment of MDA-MB-231 cells with both UTI and TAX down-regulated the expression of IL- 6, IL- 8, and TNF- a transcripts...
  • 7
  • 235
  • 0
Báo cáo y học: " Analysis of IL-12 p40 subunit gene and IFN-γ G5644A polymorphisms in Idiopathic Pulmonary Fibrosis" docx

Báo cáo y học: " Analysis of IL-12 p40 subunit gene and IFN-γ G5644A polymorphisms in Idiopathic Pulmonary Fibrosis" docx

Ngày tải lên : 13/08/2014, 13:20
... primers: 5'TTG TTT CAA TGA GCA TTT AGC ATC T and 5' GTT TCA ATG AGC ATT TAG CAT CG in combination with the consensus forward primer 5'ATC TTG GAG CGA ATG GGC AT at a final Page of (page number not ... deficit and/ or reduced gas transfer measurements, and the absence of bronchoalveolar lavage features that might suggest an alternative diagnosis In 23 of 73 patients, the diagnosis of fibrosing alveolitis ... et al http://respiratory-research.com/content/4/1/6 The 3'UTR region plays an important role in the expression of many eukaryotic genes by governing mRNA stability, localizing mRNA, and regulating...
  • 5
  • 196
  • 0
unit 12: Films and Cinema. A-reading

unit 12: Films and Cinema. A-reading

Ngày tải lên : 30/07/2013, 01:25
... A Introduction  Can you name some films you have seen recently?  Giai Cuu Than Chet  3.Titanic sing 2.Kungfu Panda Owl and Sparrow Lord of the B Have a look at the two films, find ... part of a film    film-making industry character a person in a film Task 2: Works in pairs Answers these questions • When did the history of cinema begin? • What did scientists discover at ... that time? • Did films in the early day have sound? • When were audiences able to see long films? • When was sound introduced? • What form of films appeared as the old silent films were being...
  • 14
  • 835
  • 7
Báo cáo khoa học: Human airway trypsin-like protease induces amphiregulin release through a mechanism involving protease-activated receptor-2-mediated ERK activation and TNF a-converting enzyme activity in airway epithelial cells doc

Báo cáo khoa học: Human airway trypsin-like protease induces amphiregulin release through a mechanism involving protease-activated receptor-2-mediated ERK activation and TNF a-converting enzyme activity in airway epithelial cells doc

Ngày tải lên : 30/03/2014, 11:20
... purchased from Ambion (Austin, TX, USA) The sequences of the 21-nucleotide siRNAs were sense: GCAG CAUUCGGUAAGAAAAtt and antisense: UUUUCU UACCGAAUGCUGCtg Silencer Negative Control no siRNA (Ambion) ... Khashayar R, Wong HH, Ferrando R, Wu R, Hyde DM, Hotchkiss JA, Zhang Y, Novikov A, Dolganov G & Fahy JV (2001) Mild and moderate asthma is associated with airway goblet cell hyperplasia and abnormalities ... Smithgall TE, Siegfried JM, Kamens J, Gooding WE & Grandis JR (2004) SRC family kinases mediate epidermal growth factor receptor ligand cleavage, proliferation and invasion of head and neck cancer...
  • 13
  • 242
  • 0
Báo cáo y học: "The proinflammatory cytokines IL-1β and TNF-α induce the expression of Synoviolin, an E3 ubiquitin ligase, in mouse synovial fibroblasts via the Erk1/2-ETS1 pathway" ppt

Báo cáo y học: "The proinflammatory cytokines IL-1β and TNF-α induce the expression of Synoviolin, an E3 ubiquitin ligase, in mouse synovial fibroblasts via the Erk1/2-ETS1 pathway" ppt

Ngày tải lên : 09/08/2014, 08:23
... purification kit from Promega Corporation The oligonucleotide primers used for mouse SYN were forward 5-aggcccatgtacctggccatgagg-3 and reverse 5-caggagcgcaggcagctcgtgtg-3 The QuantiTect SYBR Green ... Takayanagi H, Ogasawara K, Hida S, Chiba T, Murata S, Sato K, Takaoka A, Yokochi T, Oda H, Tanaka K, et al.: T-cell-mediated 20 21 22 23 regulation of osteoclastogenesis by signalling cross-talk ... Shikhman A, Valbracht J, Creighton-Achermann L, Lotz M: The osteoprotegerin/ receptor activator of nuclear factor kappaB/receptor activator of nuclear factor kappaB ligand system in cartilage Arthritis...
  • 10
  • 405
  • 0
Báo cáo y học: " Effects of overexpression of IL-10, IL-12, TGF-β and IL-4 on allergen induced change in bronchial responsiveness" pot

Báo cáo y học: " Effects of overexpression of IL-10, IL-12, TGF-β and IL-4 on allergen induced change in bronchial responsiveness" pot

Ngày tải lên : 12/08/2014, 16:20
... new approach Pharmacol Rev 2003, 55:241-269 Nakagome K, Dohi M, Okunishi K, Komagata Y, Nagatani K, Tanaka R, Miyazaki J, Yamamoto : In Vivo IL- 10 Gene delivery suppresses airway eosinophilia and ... suppressed Ag- induced eosinophilic airway inflammation and AHR in a dose-dependent manner Combination effect of IL- 10 and IL- 12 gene plasmid in the suppression of AHR and airway eosinophilic inflammation ... inflammation However, combination of IL- 10 and IL- 12 gene therapy did not exert the syngenic effect in the modulating airway inflammation It may imply that IL- 10 and IL- 12 have some antagonistic...
  • 14
  • 317
  • 0
Báo cáo sinh học: "Gene therapy with tumor-specific promoter mediated suicide gene plus IL-12 gene enhanced tumor inhibition and prolonged host survival in a murine model of Lewis lung carcinoma" pptx

Báo cáo sinh học: "Gene therapy with tumor-specific promoter mediated suicide gene plus IL-12 gene enhanced tumor inhibition and prolonged host survival in a murine model of Lewis lung carcinoma" pptx

Ngày tải lên : 18/06/2014, 19:20
... treated animals to measure the biochemistry markers including alanine transaminase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN) and creatine (Cr) using commercial kits (Sigma, ... and IL- 12 in tumors was determined and similar results were found as in vitro (Figure 3A and 3B) For tumor growth, the data clearly showed remarkable inhibition of combining AdCMVmIL -12 and AdhTERTHRP ... measuring cell viability, and in vivo, by determining the tumor size and animal survival, assessing both tumoral histology and infiltration of Page of 10 T-lymphocytes, and evaluating toxic studies...
  • 10
  • 696
  • 0
báo cáo hóa học:" Gene therapy with tumor-specific promoter mediated suicide gene plus IL-12 gene enhanced tumor inhibition and prolonged host survival in a murine model of Lewis lung carcinoma" doc

báo cáo hóa học:" Gene therapy with tumor-specific promoter mediated suicide gene plus IL-12 gene enhanced tumor inhibition and prolonged host survival in a murine model of Lewis lung carcinoma" doc

Ngày tải lên : 20/06/2014, 03:20
... treated animals to measure the biochemistry markers including alanine transaminase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN) and creatine (Cr) using commercial kits (Sigma, ... and IL- 12 in tumors was determined and similar results were found as in vitro (Figure 3A and 3B) For tumor growth, the data clearly showed remarkable inhibition of combining AdCMVmIL -12 and AdhTERTHRP ... measuring cell viability, and in vivo, by determining the tumor size and animal survival, assessing both tumoral histology and infiltration of Page of 10 T-lymphocytes, and evaluating toxic studies...
  • 10
  • 485
  • 0
Báo cáo y học: "DHEA-dependent and organ-specific regulation of TNF-α mRNA expression in a murine polymicrobial sepsis and trauma model" pps

Báo cáo y học: "DHEA-dependent and organ-specific regulation of TNF-α mRNA expression in a murine polymicrobial sepsis and trauma model" pps

Ngày tải lên : 13/08/2014, 18:22
... (bp) TNF- α ccaagggagagtggtcaggt ggcaacaaggtagagaggc 317 IL- 1β atcactcattgtggctgtgg gtcgttgcttggttctcct 322 IL- 10 tgctatgctgcctgctctta gctccactgccttgctctta 405 GAPDH accacagtccatgccatcac tccaccaccctgttgctgta ... WG, Bland KI, Chaudry IH: Sex steroids regulate pro- and antiinflammatory cytokine release by macrophages after traumahemorrhage Am J Physiol 1999, 277:C35-C42 Angele MK, Ayala A, Monfils BA, ... housekeeping gene glycerealdehyde-3-phosphate dehydrogenase (GAPDH) Statistics Statistical analysis was performed using a standard software application (SPSS Inc., Chicago, IL, USA) Comparisons...
  • 9
  • 319
  • 0
Báo cáo y học: " Eradication rate of Helicobacter pylori according to genotypes of CYP2C19, IL-1B, and TNF"

Báo cáo y học: " Eradication rate of Helicobacter pylori according to genotypes of CYP2C19, IL-1B, and TNF"

Ngày tải lên : 31/10/2012, 16:57
... TCG ATT CTT GGT GTT CTT TTA C, and *3F1: 5’ AAC CAG CTA Int J Med Sci 2006, GGC TGT AAT TGT, *3R1: 5’ CTT GGC CTT ACC TGG ATC, *3F2: 5’ ATT GTA AGC ACC CCC TGA, *3R2: 5’ CAC TGA TCA GGG AGC TAA ... and 636GG; *1*2, with the 681GA and 636GG; *1*3 with the 681GG and 636GA; *2*2, 137 with the 681AA and 636GG; *2*3, with the 681GA and 636GA; *3*3, with the 681GG and 636AA Table Characteristics ... two-pair primers (PCR-CTPP) [22] The primers for CYP2C19 G6 8 1A and G6 3 6A were *2F1: 5’ AGA GCT TGG CAT ATT GTA TCT, *2R1: 5’ TAA GTA ATT TGT TAT GGG TTC CC, *2F2: 5’ CCA CTA TCA TTG ATT ATT TCC CA,...
  • 6
  • 650
  • 1
Báo cáo khoa học: Platination of telomeric sequences and nuclease hypersensitive elements of human c-myc and PDGF-A promoters and their ability to form G-quadruplexes Viktor Viglasky potx

Báo cáo khoa học: Platination of telomeric sequences and nuclease hypersensitive elements of human c-myc and PDGF-A promoters and their ability to form G-quadruplexes Viktor Viglasky potx

Ngày tải lên : 23/03/2014, 06:20
... PDGF -A GGGTTAGGGTTAGGGTTAGGG GGGGTTTGGGGTTTGGGGTTTGGGGG TGGGGAGGGTGGGGAGGGTGGGGAAGG GGAGGCGGGGGGGGGGGGGCGGGGGCGGGGGCGGGG GAGGGGCGCGGC Single-strand concentrations were determined by measuring ... negative band at approximately 240 nm, whereas antiparallel G4 structures, such as basket and chair forms, show two positive bands at approximately 295 and 240 nm and a negative band at approximately ... Slovakia, Levoca, Slovakia) T4 polynucleotide kinase was purchased from Promega (Madison, WI, USA) [c-32P]ATP was purchased from Amersham (Arlington Heights, IL, USA) Cisplatin and transplatin...
  • 9
  • 324
  • 0
Báo cáo khoa học: The potyviral virus genome-linked protein VPg forms a ternary complex with the eukaryotic initiation factors eIF4E and eIF4G and reduces eIF4E affinity for a mRNA cap analogue ppt

Báo cáo khoa học: The potyviral virus genome-linked protein VPg forms a ternary complex with the eukaryotic initiation factors eIF4E and eIF4G and reduces eIF4E affinity for a mRNA cap analogue ppt

Ngày tải lên : 23/03/2014, 10:21
... cap analogues The apparent dissociation constant of m7GDP to eIF4E was higher in the presence of increasing amounts of VPg (Fig 2) The plateau value (ligand saturation) was also affected (Fig ... contained three groups of polypeptide chains according to their relative molecular masses: a group with bands in the range of 180 kDa, a 54-kDa band, and a single chain of 26 kDa (Fig 4B, lane 4) The ... blotting with polyclonal antibodies against eIF4E Lane 1, 10 lg VPgÆGst fusion; lane 2, 30 lg VPgÆGst fusion; lane 3, 60 lg VPgÆGst fusion; lane 4, 100 lg VPgÆGst fusion; lane 5, 150 lg VPgÆGst...
  • 11
  • 489
  • 0
Asthma WellnessKeeping Children with Asthma in School and Learning Liability & Litigation: A Legal Primer Asthma & Indoor Air Quality (IAQ)Asthma Management, Policies and Procedures.St r a i g h tBy Paul D. Houstont a l kIn School and Healthy: docx

Asthma WellnessKeeping Children with Asthma in School and Learning Liability & Litigation: A Legal Primer Asthma & Indoor Air Quality (IAQ)Asthma Management, Policies and Procedures.St r a i g h tBy Paul D. Houstont a l kIn School and Healthy: docx

Ngày tải lên : 23/03/2014, 23:20
... eplater@aasa.org National School Boards Association (NSBA) The National School Boards (NSBA), through its School Health Programs Department, makes available information on asthma prevention and management ... 1-888-232-6789 Information and statistical data on asthma; coordinated school health programs American Academy of Allergy, Asthma, and Immunology www.aaaai.org, 1-800-822-2762 Physician referral directory, ... and to ensure that decisions made regarding a child’s needs, and their implementation, are fair and appropriate It stipulates that schools and parents should act as partners in the planning and...
  • 16
  • 450
  • 0
báo cáo hóa học:" Angiostatin anti-angiogenesis requires IL-12: The innate immune system as a key target" docx

báo cáo hóa học:" Angiostatin anti-angiogenesis requires IL-12: The innate immune system as a key target" docx

Ngày tải lên : 18/06/2014, 15:20
... Control 4HPR AST Figure the lacks anti-angiogenic IL- 12 ASTIL -12 receptor or for activity in animals gene targeted for AST lacks anti-angiogenic activity in animals gene targeted for the IL- 12 receptor ... produce IL- 12 (Fig 2) Taken together, these data demonstrate that IL- 12 production and signaling is an integral part of AST angiogenesis inhibition AST Anti -IL- 12 - * + - + + - + - Ctrl IL- 12 Figure ... tested the ability of AST to inhibit angiogenesis in animals gene targeted for the IL- 12 p40 subunit Again, AST completely lost its capacity to inhibit angiogenesis in animals lacking the capacity...
  • 8
  • 477
  • 0
WETLAND AND WATER RESOURCE MODELING AND ASSESSMENT: A Watershed Perspective - Chapter 12 docx

WETLAND AND WATER RESOURCE MODELING AND ASSESSMENT: A Watershed Perspective - Chapter 12 docx

Ngày tải lên : 18/06/2014, 16:20
... through the landscape neutral model NPSSIM is therefore truly spatial scale independent because as long as DEM (digital elevation model), LULC, soil type, and rainfall data are available on the same ... prediction of water quality parameters Landscape indices are generally widely used tools for spatial landscape analyses and serve as standards for comparison between landscapes in different parts of ... Modeling 143 12. 2 METHODS 12. 2.1 LAND USE/LAND COVER (LULC) DATA LULC data obtained from the Michigan Geographic Data Library were derived from a classification of 2001 Landsat Thematic Mapper...
  • 9
  • 394
  • 0
báo cáo hóa học:" En bloc excision and autogenous fibular reconstruction for aggressive giant cell tumor of distal radius: a report of 12 cases and review of literature" doc

báo cáo hóa học:" En bloc excision and autogenous fibular reconstruction for aggressive giant cell tumor of distal radius: a report of 12 cases and review of literature" doc

Ngày tải lên : 20/06/2014, 04:20
... hyperparathyroidism Procedure Patients were operated under general anaesthesia and ipsilateral leg, arm and iliac crest were prepped and draped appropriately A pneumatic tourniquet was used Figure ... Newly harvested fibular graft was placed in ipsilateral forearm and radiocarpal ligaments were repaired to lateral collateral ligament After reduction of newly formed fibula carpal joint, fibular ... these days may jeopardize the vascularity of fibular graft forcing it to act essentially as a nonvascular graft [16] Moreover, long surgical time and unavailability of required expertise of a vascular...
  • 9
  • 466
  • 0
báo cáo hóa học:" En bloc excision and autogenous fibular reconstruction for aggressive giant cell tumor of distal radius: a report of 12 cases and review of literature" ppt

báo cáo hóa học:" En bloc excision and autogenous fibular reconstruction for aggressive giant cell tumor of distal radius: a report of 12 cases and review of literature" ppt

Ngày tải lên : 20/06/2014, 07:20
... hyperparathyroidism Procedure Patients were operated under general anaesthesia and ipsilateral leg, arm and iliac crest were prepped and draped appropriately A pneumatic tourniquet was used Figure ... Newly harvested fibular graft was placed in ipsilateral forearm and radiocarpal ligaments were repaired to lateral collateral ligament After reduction of newly formed fibula carpal joint, fibular ... these days may jeopardize the vascularity of fibular graft forcing it to act essentially as a nonvascular graft [16] Moreover, long surgical time and unavailability of required expertise of a vascular...
  • 9
  • 703
  • 0