fundamental of data structure using c pdf

... subcategories. Linear collections can be either direct access collections or sequential access collections, whereas nonlinear collections can be either hierarchical or grouped. This section describes each of these ... of these collection types. Direct Access Collections The most common example of a direct access collection is the array. We define an array as a collection of elements with the same data type ... instructor had to discuss the concept of, say, a stack, abstractly until the complete data structure was constructed. Instructors can now show students how to use a stack to perform some computation,...

Ngày tải lên: 22/12/2013, 10:16

... #include<iostream.h> #include<conio.h> #include<stdlib.h> void check(char[]); main(){clrscr();char s[100]; cin>>s;check(s); getch();} void check(char s[]){char c; int ... اه او #include<iostream.h> #include<conio.h> struct list{int a;list*next;list*last;}; main(){clrscr(); int j,i;list *k,*kk,*node,*head,*tile; node=new list;cin>>node->a;node->next=NULL;node- >last=NULL;tile=head=node; ... ما #include<iostream.h> #include<conio.h> struct list{int d;list*next;}; void main(void){clrscr(); list *head,*node,*tile,*k; int i=0,x,y; node=new list;cin>>node->d;node->next=NULL;...

Ngày tải lên: 05/03/2014, 20:20

Ngày tải lên: 19/03/2014, 14:09

Ngày tải lên: 22/03/2014, 17:20

Ngày tải lên: 28/03/2014, 19:20

Ngày tải lên: 08/03/2014, 02:21

Ngày tải lên: 03/07/2014, 08:20

Ngày tải lên: 03/07/2014, 08:20

Ngày tải lên: 03/07/2014, 08:20

Ngày tải lên: 03/07/2014, 08:20

... NUMERICAL RECIPES IN C: THE ART OF SCIENTIFIC COMPUTING (ISBN 0-521-43108-5) Copyright (C) 1988-1992 by Cambridge University Press.Programs Copyright (C) 1988-1992 by Numerical Recipes Software. ... NUMERICAL RECIPES IN C: THE ART OF SCIENTIFIC COMPUTING (ISBN 0-521-43108-5) Copyright (C) 1988-1992 by Cambridge University Press.Programs Copyright (C) 1988-1992 by Numerical Recipes Software. ... information. 686 Chapter 15. Modeling of Data Sample page from NUMERICAL RECIPES IN C: THE ART OF SCIENTIFIC COMPUTING (ISBN 0-521-43108-5) Copyright (C) 1988-1992 by Cambridge University Press.Programs Copyright...

Ngày tải lên: 15/12/2013, 04:15

... development cycle. Each stage of the cycle contains specific activities that you perform to achieve the best possible database design. Database Design Database design is just one of the stages of the ... Builder8Ć32 Overview of Data Modeling and Database Design 8Ć7 System Development Cycle From concept to production, develop a database by using the system development cycle. The cycle contains multiple stages of ... or views. Views can restrict access, provide improved presentation of information, and can contain a pre-packaged complex query. D Plan the physical storage space, which is the amount of space required...

Ngày tải lên: 21/12/2013, 06:17

... Principles of Data Center Infrastructure Design Page 7 Deployment The graphic below depicts a sample data center using ADC's comprehensive line of data center-grade infrastructure products. Additional ... by protecting cable and connections and offer manageability through easy identification, access and reconfiguration. Because the use of a central patching location in a cross-connect scenario ... Principles of Data Center Infrastructure Design The Three Principles of Data Center Infrastructure Design Page 5 Choosing the Right Mix of Equipment Since the total spend for network infrastructure...

Ngày tải lên: 16/01/2014, 21:20

... airfoil section, and create the airfoil section called airfoil.sec. Open a new file, and create a blend protrusion with 200 inches depth . 2 First section Second section The ... 1 ME-430 INTRODUCTION TO COMPUTER AIDED DESIGN Vibration of Airplane Wing Using Pro/M Dr. Herli Surjanhata Use Notepad or Text Editor in Unix system to create the following file called spline.pts...

Ngày tải lên: 19/01/2014, 05:20

... dụng ứng trư c điều khoản đỏ(Advanced letter of credit, Red clause letter of credit) -Thư tín dụng tuần hoàn(Revolving letter of credit) -Thư tín dụng dự phòng(Stand by letter of credit) -Thư ... dụng chuyển nhượng (Transferable letter of credit) -Thư tín dụng đối ứng(Reciprocal letter of credit) 1.Khái niệm: Phương th c tín dụng chứng từ là phương th c thanh toán trong đó theo yêu c u ... -Ngân hàng x c nhận (C onf irming bank),ngân hàng chiết khấu((Negotiating bank),Ngân hàng trả tiền ((Reimbursing bank) :c c ngân hàng này c thể c ho c không tuỳ thu c vào yêu c u c a người mua...

Ngày tải lên: 25/01/2014, 18:20

... cytochrome c triggers assembly of a caspase-9- activating complex and subsequent activation of the downstream caspase cascade. These pathways are not mutually exclusive and are connected by caspase-8, which ... attached to the culture dish. Since the detachment of cells and condensation of chromatin also occurs during mitosis [28], we tested the impact of the pan-caspase inhibitor Z-VAD-FMK on cell ... (1974) Associa- tion of mammalian cell death with a speci c endonu- cleolytic degradation of DNA. Nature 252, 754–755. 42 Bain J, McLauchlan H, Elliott M & Cohen P (2003) The specificities of protein...

Ngày tải lên: 16/02/2014, 14:20

... structure with 5 C NMR structure using the main chain of residues Ser12 fiThr70 in t he structure a lignment. (B) O verlap of the X-ray structure with the 30 C NMR structure using the main chain ... exactly causes the increase in TH activity of CfAFP-501. Dynamics of insect AFPs To determine whether changes in temperature cause changes i n t he structure of the insect AFPs and to further characterize ... the amount of librational Fig. 7. Comparison of the X-ray structures of sbwAFP isoform 337 with CfAFP-501. The structures are shown as smoothed, Ca traces, with the structure and PDB code shown...

Ngày tải lên: 19/02/2014, 16:20

... for comparison of structure and f unction. Circular dichroism experiments CD measurements were carried out on a Jasco 720 spectropolarimeter. E ach o f the peptides tested was incu- batedwithNaCl/P i or ... helix content of F13 varian t in aqueous solution at acidic pH may reflect the c ritical effect of proline on the helical propensity of the fusion peptide sequence, but this structural effect diminished ... membrane-associated fusion peptide as measured by FT-IR spectroscopy The secondary structure of peptides can also be quantitated by infrared spectroscopy. As shown i n F ig. 6 , the helical content calculated...

Ngày tải lên: 19/02/2014, 16:20

... annealed oligo- nucleotides 5¢-CTAGTCGTCCGAACTCCGATAATCGC CGTCAGGGCGGTCGCGAACGTTTAG-3¢ and 5¢-CA TGCCAAACGT TCGCGA CCGC CCTGAC GGCGAT TA TCGGAGTTCGGACA-3¢ into the unique SpeI restriction site. p13R4-DP ... for constructing p13R4-P, except that the following primers 5¢-ACTCATA CTAGTCTTAGCCATGGCTTCCCGCCG GCG-3¢ and 5¢-CCATCCGAATTCTCACTACACATTGAT CCTAGCA GAAGC-3¢ were used for the PCR amplification of ... 5¢-GACACCAGACCA ACTGGTAATGGTAGCGACCG-3¢ were used for the amplification of the 3¢ end of the b-gal gene. The presence of similar amounts of genomic DNA in the reactions was controlled by concomitant...

Ngày tải lên: 19/02/2014, 18:20

... the correct positions. Sentence → Colloc + Colloc → Word + Word → Phoneme + Figure 8: The collocation word adaptor grammar, which generates a Sentence as sequence of Colloc(ations), each of which ... each of which consists of a sequence of Words. sible for an adaptor grammar to generate a sentence as a sequence of collocations, each of which con- sists of a sequence of words. These collocations ... inference for PCFGs via Markov chain Monte Carlo. In Human Language Technologies 2007: The Conference of the North American Chap- ter of the Association for Computational Linguistics; Proceedings of...

Ngày tải lên: 20/02/2014, 09:20