from working for the boss to working for the customer
Báo cáo y học: "Does switching from oral extended-release methylphenidate to the methylphenidate transdermal system affect health-related quality-of-life and medication satisfaction for children with attention-deficit/hyperactivity disorder&
Ngày tải lên :
25/10/2012, 10:06
... if in the investigator's opinion there was potential for further symptom reduction, try the next higher dose No further titration was permitted after the final dose-adjustment visit at the end ... who failed to respond to psychostimulants in the past, and those with conduct disorder, were excluded from the study Therefore, the results of this study should not be extrapolated to these patient ... discontinued the study due to intolerable effects Four subjects withdrew from the study because of reactions at the application site that ranged from definite erythema with severe itching to normal...
- 12
- 757
- 0
Báo cáo khoa học: Examining multiprotein signaling complexes from all angles The use of complementary techniques to characterize complex formation at the adapter protein, linker for activation of T cells pdf
Ngày tải lên :
23/03/2014, 15:21
... acceptor fluorophore, leading to an increased fluorescence emission of the acceptor and a quenching of the emission fluorescence of the donor [52–54] For FRET to occur, the donor and acceptor must ... receptor-mediated signaling, degranulation and cytokine release, similar to those seen in LAT-deficient mice [39–41] Together, these data suggested that the ability of phosphorylated LAT to form ... that allows for the simultaneous measurement of the affinity, binding stoichiometry and thermodynamic constants [56–59] This study was performed to characterize the properties that drive the binding...
- 10
- 457
- 0
Tài liệu Báo cáo khoa học: Evidence for interactions between domains of TatA and TatB from mutagenesis of the TatABC subunits of the twin-arginine translocase docx
Ngày tải lên :
19/02/2014, 17:20
... cccgatgtactgtgcgtttgaaatcggtgtcttc Pro48 to Ala Ile81 to Met Pro85 to Ala Phe94 to Ala Pro97 to Ala Leu99 to Ala Glu103 to Gln Glu103 to Ala Arg104 to Ala Arg105 to Ala Phe118 to Ala Gly121 to Ala Tyr154 to Ser Phe169 to Ala ... Glu8 to Gln Glu8 to Ala Leu11, Val12 and Phe13 to Gly Val12 to Pro Gly21 to Ala Pro22 to Gly Pro22 to Leu Leu25 to Ala Pro26 to Ala Leu63 to Ala Arg37 and Arg40 to Asn Lys64, Lys65 and Lys68 to ... with the exception of F39A, where all of the TorA is present as the cytoplasmic form Some cytoplasmic TorA is also evident with L25A The TorA-GFP export assays are in good agreement with the TorA...
- 15
- 532
- 0
Strong Performers And Successful Reformers In Education Lessons From PISA For The United States doc
Ngày tải lên :
22/03/2014, 16:22
... techniques they employed The aim of the American firms was to learn enough from their competitors to beat them at their own game To this, they identified their most successful competitors But they ... Thus, the purpose of the assessments is to inform countries on the degree to which their students are prepared for life Decisions about the scope and nature of the PISA assessments and the background ... files from the printed page! Look for the StatLinks at the bottom left-hand corner of the tables or graphs in this book To download the matching Excel® spreadsheet, just type the link into your Internet browser,...
- 259
- 407
- 0
Báo cáo lâm nghiệp: "High potential for increase in CO2 flux from forest soil surface due to global warming in cooler areas of Japan" ppt
Ngày tải lên :
07/08/2014, 16:20
... contribute to the opposite trend to some extent The quality of organic carbon is a crucial factor for determining CO2 emission from the soil The ratio of cellulose to hemicellulose to lignin was ... production, which is related to the input of organic matter to the soil [16, 18] Therefore, the relationship between the quality and quantity of soil carbon and CO2 flux from the soil surface, and litter ... respiration was found to increase for the initial years to 28% of the respiration before the experiment, but respiration was negligible from the tenth year onward, suggesting that the consumption of...
- 10
- 431
- 0
báo cáo khoa học: "Naturally occurring nanoparticles from English ivy: an alternative to metal-based nanoparticles for UV protection" doc
Ngày tải lên :
11/08/2014, 00:22
... without exposure to UV In addition to the increased potential for DNA damage from engineered metal oxide nanoparticles, another concern for their application in cosmetics is the potential for inhalation, ... HeLa cells for 24 hours to test the cytotoxicity of these ivy nanoparticles The toxicity was determined using propidium iodide staining and was examined by flow cytometry We observed no toxicity ... nanoparticles is their probability to penetrate through the skin into the circulatory system [37,38] The development of proper markers for the detection of ivy nanoparticles in the skin takes considerable...
- 9
- 315
- 0
Báo cáo y học: "A scale of functional divergence for yeast duplicated genes revealed from analysis of the protein-protein interaction network" doc
Ngày tải lên :
14/08/2014, 14:21
... divergence of the yeast duplicated genes, we analyzed available textual information relative to the actual functions of the 460 pairs of paralogs from the WGD For this purpose, we used the Gene Ontology ... is able to take into account the structure of the ontology in the comparison process We performed a pairwise comparison of the functions of the 460 pairs of duplicates by processing their functional ... 2) Among them, 154 correspond to products of duplicated genes from the ancient duplication and 82/154 form 41 pairs of paralogs These 41 pairs thus correspond to the only pairs from the ancient...
- 13
- 209
- 0
Applying the technique of guessing word meanings from context for 11th form students at Le Loi high school = Sử dụng kỹ năng đoán nghĩa từ qua ngữ cảnh đối với
Ngày tải lên :
28/03/2015, 09:26
... bottles After customers empty the bottles, they return them to the store The manufacturers of the drinks collect the bottles, wash them, and then fill them again The energy that is necessary to make ... teacher gave a text for the students to list out the words they did not know and then to try to guess their meanings The text was printed and delivered to the students The students did the task in twenty ... conducted from the middle of the first semester to the beginning of the second semester of the school-year, there were some problems relating to the consistency of the participants Some students in the...
- 68
- 981
- 1
Getting closer to the customer a challenge for the c suite
Ngày tải lên :
04/12/2015, 00:11
... marketing and customer service © The Economist Intelligence Unit Limited 2012 Getting closer to the customer A challenge for the C-suite ❛❛ Companies in the past did not treat the customer experience ... response The onus is now on the C-suite to provide the clear direction that has to date often been lacking Respondents say that the best way to improve customer communication in the future is for the ... services For that reason, customer service, and other functions beyond marketing, need to be part of the dialogue between company and customer Customer comments on networking sites and the preferences...
- 30
- 192
- 0
Welcome to the customer success platform for communications
Ngày tải lên :
07/03/2016, 18:19
... selling to larger enterprise customers Further information on potential factors that could affect the financial results of salesforce.com, inc is included in our annual report on Form 10-K for the ... quarterly report on Form 10-Q for the most recent fiscal quarter These documents and others containing important disclosures are available on the SEC Filings section of the Investor Information section ... LAN / WAN Client Millions Billions connected things Trillions customer interactions The Customer Gap Customers Your Company 77% of customers are not engaged with companies Not engaged with: Your...
- 20
- 304
- 0
Welcome to the customer success platform for financial services
Ngày tải lên :
07/03/2016, 18:19
... selling to larger enterprise customers Further information on potential factors that could affect the financial results of salesforce.com, inc is included in our annual report on Form 10-K for the ... immense The Banking sector has not yet felt the full Everybody is going back to their core customer And Our industry will go through the same disruptive force of technology But it will they’re ... quarterly report on Form 10-Q for the most recent fiscal quarter These documents and others containing important disclosures are available on the SEC Filings section of the Investor Information section...
- 16
- 269
- 0
DSpace at VNU: The search for a new understanding of Vietnam: achanging view from Korea in the late nineteenth century and the early twentieth century
Ngày tải lên :
16/12/2017, 01:35
... interested in the history of foreign countries, introduced briefly Vietnamese history from the twelfth century to the eighteenth century with the words: The foreign countries of the same script ... usso-Jap an ese W ar, the attempt to analyze the cause o f the ruin o f V ie tn a m from various angles helped the country to be used as the criterion for evaluating the present and the future o f K ... in V ietn am all thanks to the efforts o f the F re n ch m issionaries there, and, according to the law o f ju n e le , this made it possible for F n ce to take over the landed property o f V...
- 27
- 194
- 0
Tài liệu Báo cáo khoa học: Switching of the homooligomeric ATP-binding cassette transport complex MDL1 from post-translational mitochondrial import to endoplasmic reticulum insertion pptx
Ngày tải lên :
18/02/2014, 16:20
... and -11 relative to the cleavage site The leader sequence interacts with the TOM receptor, responsible for the translocation of the preproteins to the translocase of the inner mitochondrial membrane ... (ABCB9) [23] We therefore set out to target MDL1 from mitochondrial import to insertion into the ER membrane in order to perform similar analyses An introduced ClaI restriction site and the endogenous ... coupled to its post-translational targeting to the mitochondrial membrane Discussion Most mitochondrial proteins are synthesized by free ribosomes in the cytosol Once released into the cytoplasm...
- 13
- 615
- 0
EFFECTED FROM WOMEN ON THE BOARD TO BANK PERFORMANCE
Ngày tải lên :
07/03/2014, 15:43
... be independent from the company The role of the board is to monitor the managers of a corporation, acting as an advocate for stockholders In essence, the board of directors tries to 15 make sure ... trying to put them to use The mean value of Tobin’s q from 2008 to 2012 was 1.009 Its means that the banks have a promising future and developing in the future Tobin’s q oscillates from 0.94 to 1.68 ... from a variety of disciplines and traditions They are used to learn directly from others what is important to them, to provide the context necessary to understand quantitative findings, and to...
- 51
- 316
- 0
WJEC GCSE in English Language For Teaching from 2010 For Award from 2012 ppt
Ngày tải lên :
10/03/2014, 05:20
... show the importance of questioning skills in the classroom (Questions can be used to bring the class to order, to make polite requests, to rebuke, to set the topic, to elicit information, to create ... assessment, and the results from that terminal assessment must contribute to the subject award Therefore, any previous results for the unit(s) that are being used to satisfy the requirement for 40% terminal ... may be used to support the study of the text but the assignment must be based on the written text Tasks will be published on the WJEC secure website in the April of the year before the year candidates...
- 43
- 548
- 0
HEALTH BENEFITS TO CHILDREN FROM CONTACT WITH THE OUTDOORS & NATURE pot
Ngày tải lên :
16/03/2014, 05:20
... specific populations (e.g., children and the elderly) Townsend and Weerasuriya then move on to discuss the benefits of nature contact to mental health for the population in general, as well as specific ... wilderness therapy and horticulture therapy Townsend and Weerasuriya also discuss evidence concerning impacts to mental health from animal contact, ranging from contact with pets to therapeutic ... opportunities for children to be physically active For example, the authors review evidence regarding neighborhood factors that influence how children get to and from school, as well as how often they...
- 46
- 434
- 0
Báo cáo khoa học: "Extracting a Representation from Text for Semantic Analysis" doc
Ngày tải lên :
23/03/2014, 17:20
... a facet is (1e) above, connecting the proposition the brass ring did not stick to the nail to the proposition the ring is not iron In addition to specifying the headwords of inter-propositional ... (1d’) (1e) (1e’) The brass ring would not stick to the nail because the ring is not iron NMod(ring, brass) The ring is brass Theme_not(stick, ring) The ring does not stick Destination _to_ not(stick, ... incorporated into the dependency types The verb’s predicate is reattached to its subject, which becomes the governor, and the dependency is labeled with the verb’s root In our example, the two semantically...
- 4
- 265
- 0
Báo cáo khoa học: Constitutive expression of the human peroxiredoxin V gene contributes to protection of the genome from oxidative DNA lesions and to suppression of transcription of noncoding DNA pdf
Ngày tải lên :
30/03/2014, 11:20
... obtained from the Cell Culture Collection of the Institute of Cytology RAS (St Petersburg), and the nonsmall cell lung carcinoma line U1810 was obtained from the Cell Line Collection of the Karolinska ... constitutive (basal) expression of the PRDX5 gene It should be noted that the potential binding site for the ubiquitous transcription factor NF-1 is located kb upstream of the PRDX5 transcription start ... of PRDX5 is known to be located in mitochondria [13] and associated with the mitochondrial matrix (A V Kropotov et al., unpublished results) However, NRF2 may be required for the maintenance of...
- 11
- 463
- 0