from when the world was good a novel

The role of caspase 1 in a murine model of influenza pneumonitis, and studies on cell death inhibitors in vitro

The role of caspase 1 in a murine model of influenza pneumonitis, and studies on cell death inhibitors in vitro

... DNA extraction, was also performed The animal was manually restrained and one clean cut was made through the tail using an alcohol-sterilized scissors Care was taken to ensure that tissue taken ... RNA Samples were regarded as pure if A2 60/280 was approximately The ratio of the absorbance at 260 and 230 nm (A2 60/230) was used as a secondary measure of RNA purity from organic compounds Samples ... inactivates the caspase via a covalent thioester bond to an adjacent cysteine residue in the transition state (Walker, Talanian et al 1994) An example is Ac-DVAD-FMK 16 In mice models, the pan-caspase...

Ngày tải lên: 13/10/2015, 16:41

190 824 0
Determinants of General Health Status and Specific Diseases of Elderly Women and Men: A Longitudinal Analysis for Western and Eastern Germany doc

Determinants of General Health Status and Specific Diseases of Elderly Women and Men: A Longitudinal Analysis for Western and Eastern Germany doc

... Christian.Wegner@oeaw.ac.at Marc Luy is Senior Scientist at the Vienna Institute of Demography of the Austrian Academy of Sciences Email: Mark.Luy@oeaw.ac.at Determinants of General Health Status and ... could further use information about the age at starting and the age at quitting to smoke Using these data we calculated the number of smoking years (measured as a continuous variable) and combined ... Germany only the transition from bad health at baseline could be analysed The number of people suffering from the specific diseases at baseline was generally to low to allow a detailed analysis...

Ngày tải lên: 22/03/2014, 13:20

61 545 0
methods and reagents for green chemistry an introduction

methods and reagents for green chemistry an introduction

... effect the changeover from fossil raw materials to biofeedstocks—that is, primarily, to carbohydrates as these are more accessible from agricultural crops and waste materials than any other natural ... variable than that of their polymers 25 2.1 AVAILABILITY OF MONO- AND DISACCHARIDES 2.1 AVAILABILITY OF MONO- AND DISACCHARIDES Table 2.1 lists the availability and bulk-quantity prices of the ... It was then proved that the U-4CRs of chiral a- ferrocenyl-alkylamines can form diastereomeric a- aminoacid derivatives stereoselectively, and it was further shown that after the reaction the a- ferrocenyl...

Ngày tải lên: 06/07/2014, 15:19

333 307 0
Báo cáo khoa hoc:" Folic acid modified gelatine coated quantum dots as potential reagents for in vitro cancer diagnostics" pdf

Báo cáo khoa hoc:" Folic acid modified gelatine coated quantum dots as potential reagents for in vitro cancer diagnostics" pdf

... confirm that the increased upatke was related to FA, a competition assay was performed with free FA In the case of QD (C) internalisation was reduced by free FA to the same level as QD (A) alone As ... potentially available for recoginition but also increasing the hydrodynamic radius of the particles The presence of FA on the surface also lead to an increase in the surface charge owing to the ... than QD (A) although they had the same quantum yield T2 is associated with the surface state recombination of charge carriers Therefore, a shorter T2 meant the surface defects and hence non- radiative...

Ngày tải lên: 11/08/2014, 08:20

7 297 0
Báo cáo y học: "Impact of the Kenya post-election crisis on clinic attendance and medication adherence for HIV-infected children in western Kenya"

Báo cáo y học: "Impact of the Kenya post-election crisis on clinic attendance and medication adherence for HIV-infected children in western Kenya"

... is also the Pediatrician-InCharge for the AMPATH Pediatric HIV Care Program and the Neonatal Unit of Moi Teaching and Referral Hospital ES is a Data Manager for AMPATH, based in Eldoret, Kenya ... study and participated in the acquisition of data and qualitative analyses He revised the manuscript critically and gave final approval for publication ES and BM organized the study data, contributed ... Katawera A, Cooper C, Small W, Anema A, Mills E: Adherence to antiretroviral therapy among a conflictaffected population in Northeastern Uganda: a qualitative study AIDS 2008, 22:1882-1884 Waki...

Ngày tải lên: 25/10/2012, 10:31

10 696 0
Tài liệu Preparing the Western Cape for the Knowledge Economy of the 21st Century ppt

Tài liệu Preparing the Western Cape for the Knowledge Economy of the 21st Century ppt

... African Development Community SALGA South African Local Government Association SANCO South African National Civics Organisation SAQA South African Qualifications Authority SATOUR South African ... to and from major world capitals, and the upgrading of the commuter rail system The distribution of natural gas by long-distance pipeline from the Namibian and West Coast gas fields to Saldanha ... Area (SACA) - Botswana, Lesotho, Namibia and Swaziland Because they are all members of the same customs area, it is difficult to disaggregate accurate figures for exports and imports White Paper...

Ngày tải lên: 27/01/2014, 12:20

96 557 0
REGIONAL OFFICE FOR THE WESTERN PACIFIC BUREAU REGIONAL DU PACIFIQUE OCCIDENTAL pdf

REGIONAL OFFICE FOR THE WESTERN PACIFIC BUREAU REGIONAL DU PACIFIQUE OCCIDENTAL pdf

... 61% of deaths from diarrhoea, 57% from malaria, 52% from pneumonia and 45% from measles Latest demographic and health surveys (DHS) and national statistics from countries and areas in the Region ... Vanuatu China Fiji Micronesia Mongolia Nauru Philippines Samoa Tonga Tuvalu Viet Nam American Samoa Australia Brunei Darussalam Cook Islands French Polynesia Guam Hong Kong (China) Japan Korea, Republic ... Republic of Malaysia Macao (China) New Caledonia New Zealand Niue Northern Mariana Is Palau, Republic of Singapore Tokelau Wallis and Futuna • Essential package for child survival • Deworming...

Ngày tải lên: 05/03/2014, 10:20

36 371 0
Environmental Code of Practice for Poultry Farms in Western Australia pptx

Environmental Code of Practice for Poultry Farms in Western Australia pptx

... image of ‘clean and green’ to the consumer It is therefore an effective marketing tool Best practice is to adhere to the standards, which are available from Standards Australia at ... on farms, for example the National Egg Quality Assurance Program There are many factors relating to application, disposal and storage of pesticides that can minimise the risk of potential water ... have incorporated practical measures to manage impacts The industry is leading the way by promoting best management practices as an industry standard and encouraging farmers to meet this standard...

Ngày tải lên: 17/03/2014, 10:20

73 521 0
Báo cáo lâm nghiệp: "A growth model for Pinus radiata D. Don stands in north-western Spain" doc

Báo cáo lâm nghiệp: "A growth model for Pinus radiata D. Don stands in north-western Spain" doc

... and t0 represent the predictor stand basal area (m2 ha−1 ) and age (years), and G is the predicted stand basal area at age t The Korf base equation was also used to develop a stand basal area ... growth The GADA was used to develop a function for projecting stand basal area This requires having an initial value for stand basal area at a given age, which may generally be obtained from a common ... diameter at breast height is measured If the initial stand basal area is not known, it must be estimated from other stand variables by use of an initialization equation The stand basal area growth...

Ngày tải lên: 07/08/2014, 16:21

13 392 0
báo cáo khoa học: ""I washed and fed my mother before going to school": Understanding the psychosocial well-being of children providing chronic care for adults affected by HIV/AIDS in Western Kenya" pdf

báo cáo khoa học: ""I washed and fed my mother before going to school": Understanding the psychosocial well-being of children providing chronic care for adults affected by HIV/AIDS in Western Kenya" pdf

... health 2008, 13:904-913 Mshana GH, Wamoyi J, Busza J, Zaba B, Changalucha J, Kaluvya S, Urassa M: Barriers to accessing antiretroviral therapy in Kisesa, Tanzania: A qualitative study of early ... Figure Diagram1of Meanings attached to caring Diagram of Meanings attached to caring Samuel was years old when he first realised that his father was ill He noticed his father's swollen hands and joints ... such as cleaning the house, washing utensils and fetching water" The workload was heavy and interrupted with a change when her mother was admitted to the hospital In the absence of adequate nursing...

Ngày tải lên: 11/08/2014, 14:21

10 308 0
báo cáo khoa học:" Cephalometric norms for the Saudi children living in the western region of Saudi Arabia: a research report" potx

báo cáo khoa học:" Cephalometric norms for the Saudi children living in the western region of Saudi Arabia: a research report" potx

... 1) The mean value, standard deviation and range of each variable was calculated and compared with the norms established for Saudi adults living in the western region of Saudi Arabia [4] In addition, ... cephalometric values was established for Saudi children The resulting data (means and standard deviation) were represented diagrammatically in the form Table and figure show the mean and standard ... plane and Frankfort horizontal plane Intersection between NPog plane and Frankfort plane Maxillary apical base relationship to anterior cranial base Mandibular apical base relationship to anterior...

Ngày tải lên: 11/08/2014, 23:22

6 377 0
Báo cáo y học: " A duplex real-time reverse transcriptase polymerase chain reaction assay for detecting western equine and eastern equine encephalitis viruses?" docx

Báo cáo y học: " A duplex real-time reverse transcriptase polymerase chain reaction assay for detecting western equine and eastern equine encephalitis viruses?" docx

... than 50% The probe for EEEV was labeled with the reporter HEX at the 5′ end and TAMRA at the 3′ end, and the probe for WEEV was labeled with the reporter FAM at the 5′ end and TAMRA at the 3′ end ... start EEE-F TGTGCGTACCTCCTCATCGTT 335 EEE-R GACTGGCGTGAATCTCTGCTT 414 EEE-Probe HEX364 AGCAGCCTACCTTTCCGACAATGGTTGTCTAMRA WEE-F AGGGATACCCCCGAAGGTT 8220 WEE-R GTGAATAGCACACGGGTGGTT 8322 CTTTCGAATGTCACGTTCCCATGCG ... of the in vitro-transcribed RNA The amplification blot for EEEV (A) and the associated standard curve graph (B)for EEEV, The amplification blot for WEEV (A) and the associated standard curve graph...

Ngày tải lên: 12/08/2014, 01:22

5 278 0
improving customer service quality for individual customers at bank for investment and development of vietnam - western hanoi branch

improving customer service quality for individual customers at bank for investment and development of vietnam - western hanoi branch

... view at BIDV Western Hanoi branch from all transactions and headquarters - Timeframe: Data was collected during the period from the year 2009 to 2012, in which the secondary data was collected from ... structure and the bank's reputation 20 20 Any business that wants to business on the market must have a certain financial capacity For operation the bank financial strength is an important factor in the ... control of the new law since the establishment as well as during operation is inevitable The law creates a legal basis for the operation of the bank in the form of the Law, the laws, ordinances,...

Ngày tải lên: 01/11/2014, 03:32

95 768 0
Application of genetic markers for identification of halophila members and genetic variation of halophila ovalis from western pacific to eastern indian ocean

Application of genetic markers for identification of halophila members and genetic variation of halophila ovalis from western pacific to eastern indian ocean

... Vietnam Florida, USA Malaysia Australia Florida, USA Costa Rica Malaysia Nakagusuku, Japan Nakagusuku, Japan Oaura, Japan Izena Island, Japan Nha Trang, Vietnam Italy Bali, Indonesia Sumbawa, Indonesia ... Indonesia Kagoshima, Japan Nha Trang, Vietnam Odawa Bay, Japan Mutsu Bay, Japan Suou-Ohshima, Japan Philippines Guam Flores Island, Indonesia Dingo Beach, Australia Trang, Thailand Trang, Thailand Nakagusuku, ... citation Halophila sp Halophila decipiens Halophila engelmannii Halophila ovalis Halophila ovalis Halophila ovalis Halophila ovalis subsp ramamurthiana Halophila ovata Halophila beccarii Halophila...

Ngày tải lên: 20/05/2016, 16:28

170 346 0
ETSI WIDEBAND CDMA STANDARD FOR THE UTRA FDD AIR INTERFACE.pdf

ETSI WIDEBAND CDMA STANDARD FOR THE UTRA FDD AIR INTERFACE.pdf

... VARIABLE SPREADING BANDWIDTH In a paper written by Adachi, Sawahashi, and Suda [13], an experiment was conducted to analyze the effects of the spreading chip rate on the BER performance with and ... BS in a cell, or how variable data rates are achieved As shown in the experiment by Adachi, Sawahashi, and Suda, BER performance generally improves with increasing chip rate W-CDMA is a mature ... Physical Channel Format The following table indicates the various parameters of the physical channel Spreading Code Chip Rate 4.096 Mcps (higher chip rates also available) Variable Spreading Factor...

Ngày tải lên: 04/08/2012, 14:24

28 930 0
w