from the point of view of a chemist

... are available on the experimental application of CHP Gasification mechanism The major chemical reactions that occur during gasification are summarized as shown in Table The heat that supports the ... [22] As the raw gas exits the gasifier it enters the cyclone in a tangential manner The tangential entry results in a spiral flow of gas beginning at the cylindrical part of the cyclone to the conical ... thermaCAM (infrared camera) with a temperature range of −20 °C to 250 °C and an accuracy of ±2°C FLIR thermaCAM (infrared camera) is a non contact instrument that can visualize the temperature distribution...

Ngày tải lên: 02/08/2016, 10:03

... pay high costs for Media Companies because their products advertised many times a day and many different channels In addition to payment for famous stars LEAFLET  STRENGTHS  Advertising leaflets ... usually receive the leaflets after that they throw away or if they read it but they can’t remember information of the suppliers NEWSPAPER   STRENGTHS The suppliers can be widely publish to the ... the costs of advertisement by the leaflets because the fee is fairly cheap compared with other types LEAFLET   WEAKNESSES Advertising leaflets can not create the trust for customers The customers...

Ngày tải lên: 02/06/2014, 15:10

... prediction and the available transcriptome data, can be applied for the initial detection and isolation of NRPs [20] Furthermore, this approach substitutes the CAS assay-guided fractionation and enabled ... (Hartmann Analytic, Braunschweig, Germany) was added The supernatants were extracted with XAD16 resin after an additional days of growth The dried eluate was dissolved in 10% methanol and analyzed ... investigated On the basis of the analysis of the S erythraea genome, transcriptome and the structural characterization, an NRPS-dependent assembly of erythrochelin mediated by a tetramodular NRPS...

Ngày tải lên: 16/02/2014, 09:20

... metropolitan areas complained of narrowness of their houses in the 1960 s At the time, airtight houses started to be built in urban area, and air pollution due to a lack of fresh air because of the ... Simultaneously, a new standard was added to the Japanese Industrial Standard (JIS) that the method of measuring the chemical emission rate from architectural materials should be divided grades.151) ... (in Japanese) IPCS (1989) Environmental Health Criteria 89 Formaldehyde, World Health Organization, Geneva Takeda, M., Saijo, Y., Yuasa, M., Kanazawa, A. , Araki, A and Kishi, R (2009) Relationship...

Ngày tải lên: 17/02/2014, 22:20

... federal agencies We also analyze the fairly crude estimates of the cost of a military person-year that result from the application of these data We then present the official DoD costs of military ... by the Department of the Treasury From the standpoint of the FG, accrual is therefore not a cost at all but rather an intragovernmental transfer payment the movement of money from one budget account ... starting point The nature of modern warfare and modern casualty treatment options have changed the ratio and cost of deaths and disabilities drastically 12 The Cost of a Military Person-Year...

Ngày tải lên: 17/02/2014, 23:20

... Preparation of crab sera Freshwater field crabs, Paratelphusa jacquemontii were collected from the local wetlands of Kanyakumari district, India The crabs used for experimental purpose were of either ... by affinity chromatography It yielded a 2000-fold increase in specific activity Analysis of the lectin on SDS/PAGE gave a single band at apparent molecular mass of 34 kDa The binding affinity of the ... Denmark 47 Kamiya, H & Ogata, K (1982) Hemagglutinins in the acorn barnacle Balanus (Megabalanus roseus): purification and characterization Nippon Suisan Gokkaishi 48, 1427 48 Kamiya, H., Muramoto,...

Ngày tải lên: 21/02/2014, 00:20

... makes the worm a chrysalis, and the chrysalis a butterfly, and the butterfly dust? And is it sin, which makes the child a man, and the man a gray-haired man, and the gray-haired man dust? And what ... landscape on either bank seems to change But then come the cataracts of life They are firmly fixed in memory, and even when we are past them and far away, and draw nearer and nearer to the silent ... hearts gradually and irresistibly, as they won the hearts of the apostles and early Christians, confront us from the earliest childhood as the infallible law of a mighty church, and demand of...

Ngày tải lên: 06/03/2014, 08:20

... placed in glass test tubes Radioactivity was measured using a gamma counter (LKB, Wallac, Finland) All animals were maintained and handled according to local and national ethical guidelines Animal ... because it may form the basis of a drug acting in pathological situations involving the overexpression of TNF -a Materials and methods Preparation of rIris, mutant L33 9A and the cleaved forms of ... cytokine analysis (MCP-1, TNF -a, IL-6, IL-10, IL-1b) All animals were maintained and handled according to local and national ethical guidelines Statistical analysis Data are represented as means ±...

Ngày tải lên: 07/03/2014, 01:20

... synthesized from poly (A) + mRNA using M-MLV reverse transcriptase The cDNA was joined with the adaptor provided by the kit (5¢-gcugauggcgaugaaugaacacugcguuugCUGG CUUUGAUGAAA-3¢) using T4 DNA ligase ... were analyzed manually and automatically by SEQUEST software The acquisition and deconvolution of data were performed with the XCALIBUR software on a Windows NT PC data system Determination of ... mV) of lM phaiodotoxin Data are presented as a Boltzmann sigmoidal fit Each point represents the mean ± SEM of data from five experiments (C) Superimposed graphics of the activation and steady-state...

Ngày tải lên: 07/03/2014, 16:20

... solution The latter has the additional attributes of being available anywhere, at anytime and on any device If it was only a simple as a mouse-trap The complication is that for most customers they already ... when assessing cloud value AMS is the paradigm where a predefined level of demand is managed internally and the remainder augmented with cloud services The apothegm is ‘Own the base and rent the ... peak’ Conclusion The customer’s overall cloud health starts with an assessment of value The assessment of value of cloud services can only include a comparison against other cloud providers The...

Ngày tải lên: 09/03/2014, 02:20

... CGCGGATCCAATCTTGATGGGGC AGCCGGAGAGG AGGAYTCTCTGGATAGTGG CTCACCACAGACGATWTCC CGGTAAGCCCATAACGCCCA CAGGCCAGGATTTGCAGCC CATAAACAYGAGCCAGTTGCC GAGTGGATGCACAGTCGTTG GAAACGGAGGTAGTGACACAT GCCTGCTCGAATTCGGGATG ... GCCTGCTCGAATTCGGGATG CTCCTTCTTGCACAAAAAGTG CTGCTCGAATTCGGGATG GTCYGGGTAATTCCTATATA GTGATCGAATTTGGGAAGATGATCCA CCCTTGCATTTAAACCTCAGGTACAC a Specific primers used for amplification of the Bov-B LINE retroposon; ... PLA3G1 (R) PLA5G2 (F) PLA3G2 (R) PLA3G4 (R) ARTFa (F) ARTRa (R) AtxBFb (F) AtxBrcb (R) AtxACFc (F) AtxACrcc (R) AmlFd (F) Amlrcd (R) CAGGAAACAGCTATGAC CGGAATTCTGAAGGTGGCCCGCC AGGTGACAG CGCGGATCCAATCTTGATGGGGC...

Ngày tải lên: 17/03/2014, 03:20

... through language use Grabe and Kaplan [5] also emphasize that only teachers who understand theory and make a transition from theory to practice can make the most appropriate decisions for a successful ... first language Many EFL teachers in Vietnam also regard this as a vital reason when analyzing their learners’ errors Nonetheless, as Savignon [15] puts it, the analysis of learners’ errors by means ... in an insightful manner (Bardovi-Harlig, [1]) In the examples, (1) Mary is talking to a man The man is Mary’s father, and (2) The man who Mary is talking to him is her father, we can see that...

Ngày tải lên: 22/03/2014, 10:20

... Rha, which could be obtained as a result of the incomplete substitution with ara4dHex or partial cleavage of terminal ara4dHex during isolation of the OPS by mild acid degradation of the LPS The ... GLC-MS of the partially methylated alditol acetates (Table 1) revealed terminal ara4dHex, 3-substituted Fuc and 3,4-disubstituted Rha as the main constituents, as well as a small amount of 3-substituted ... Chemical studies on the core oligosaccharide Fraction P3 (core oligosaccharide) was obtained from LPS-I and LPS-II at a yield of 44% and 21% of the total material eluted from the column of Sephadex...

Ngày tải lên: 23/03/2014, 17:22

... aspartate (Asp378 in PMA1_NEUCR), several cavities are also seen at the same position in ATC1_RABIT (data not shown) Aside from mutations directed against a small stretch of amino acids adjacent to the ... structural data are available MATERIALS AND METHODS Building the 3D model of PMA1_NEUCR In our approach, the model of PMA1_NEUCR was built using the ATC1_RABIT crystal structure as template by ... (1994) Computer analysis of bacterial haloacid dehalogenases defines a large superfamily of hydrolases with diverse specificity Application of an iterative approach to database search J Mol Biol...

Ngày tải lên: 23/03/2014, 21:20

... we have described are heuristic aids rather than failsafe procedures for the rapid construction of a sizeable and accurate lexicon from s machine-readable dictionary of variable accuracy and ... for example, the morphological features AT, LAT and BARE_ADJ are not there This type of feature is critical to the analysis of derivxtional variants, and such information is necessary for the correct ... V and BAR, used to define the major categories of the grammar, most features can be classlfied in terms of the categories they apply to For each major category type there is a set of head features...

Ngày tải lên: 24/03/2014, 02:20

... this is the case, removal from the action of the ataxia telangiectasia mutated (ATM) ⁄ ataxia telangiectasia and RAD53 related (ATR) kinases at the site of DNA damage may decrease the kinase ⁄ ... response At sites of DNA damage, the Ser129-phosphorylated H2AX derivative, cH2AX, forms foci for the recruitment of factors involved in repair of DNA damage and maintenance of the cell cycle arrest ... in the appearance of a ‘smear’ of low molecular mass DNA species that may represent some chromosome degradation (Fig 5, psy4D, h) When WT cells were washed free of the DNA-damaging agents and allowed...

Ngày tải lên: 30/03/2014, 04:20

... interaction with their membranes Materials and methods Materials All chemicals were of the purest analytical grade available Proteases, aprotinin, lysozyme, and a- casein were from Sigma-Aldrich ... concentration, v0 was calculated for each concentration of the inhibitor by nonlinear t of the data from the above negative controls; [I] is the concentration of the inhibitor, IC50 is the concentration ... incubated for h at 37 C, and the assay was considered positive if agglutination was apparent to the naked eye Results Protein isolation and sequence assignments The acidic extract prepared from the...

Ngày tải lên: 30/03/2014, 13:20

... representation language An O /A database consists of a collection of objects, each of which has a unique identifier and a type, and arrows, each of which has a unique identifier, a type, and source and ... the same ideals In addition, we aim to test the claims that the RAGS data model approach supports the flexible processing of information in an NLG setting The RAGS data model The starting point ... DocLeafs) and DocLeafs The active database server supports multiple independent O /A databases Individual modules of an application publish and retrieve objects and arrows on databases, incrementally...

Ngày tải lên: 31/03/2014, 04:20

... a leading Quaker of his day, came forward as a promoter of the religious training of the slaves as a preparation for emancipation.[3] William Penn advocated the emancipation of slaves,[4] that ... ignorance of the slaves as an argument against their emancipation, the antislavery men's problem became the education of the master as well as that of the slave Believing that intellectual and moral ... some of them.[4] [Footnote 1: Davis was a logical antislavery agitator He believed that if the slaves had had the means of education, if they had been treated with humanity, making slaves of them...

Ngày tải lên: 31/03/2014, 18:20