from equation 1 5 54 the thickness of t
Báo cáo y học: "The angiogenesis inhibitor protease-activated kringles 1–5 reduces the severity of murine collagen-induced arthritis" ppsx
... 2. 41 ± 0 .11 ** 2. 41 ± 0 .10 ** 2.42 ± 0 .11 ** 1. 91 ± 0.04 1. 96 ± 0.08 1. 91 ± 0.09 1. 92 ± 0 .10 2 .14 ± 0 .13 2 .16 ± 0 .12 2. 21 ± 0 .12 2.20 ± 0 .12 2.20 ± 0 .11 2 .19 ± 0 .16 From the day of arthritis onset, ... polyclonal antibodies [20, 21] These examples support the concept that antiangiogenic therapies may be a potentially useful tool in the treatment of arthritis In addition to blocking the activity of proangiogenic ... most of K5 – a potent inhibitor of endothelial cell proliferation [26,27] We chose to administer K1 5 after the onset of macroscopic signs of arthritis because we believe that this therapeutic...
- 8
- 257
- 0
iec 60364-5-54 electrical installations of buildings - selection and erection of electrical equip
... equipment Chapter 54 : Earthing arrangements and protective conductors 5 41 GENERAL 5 41. 1 The performance of the earthing arrangements shall satisfy the safety and functional requirements of the electrical ... requirements of the installation 54 2 .1. 2 The selection and erection of the equipment of the earthing arrangements shall be such that: - the value of earthing resistance is in accordance with the protective ... electrochemical deterioration; b) their conductance shall be at least equal to that resulting from the application of Clause 54 3 .1; c) they shall permit the connection of other protective conductors at every...
- 35
- 753
- 10
Tài liệu Actions Against Abuse of the Global Financial System: Report from G7 Finance Ministers to the Heads of State and Government docx
... system If there is obscurity about their ownership, banks and other financial institutions may not be able to discover the identity of the beneficiary of the account and will be unable to meet their ... and the integrity of the IFIs themselves Thus, we urge the IMF and the World Bank to continue to conduct an authoritative review of their financial procedures and controls and those of recipients, ... practices In this respect, we support the continuation of the efforts of the OECD member countries to eliminate any harmful features of their preferential tax regimes We welcome the public commitments...
- 8
- 485
- 0
Tài liệu Báo cáo khoa học: Gene transcription of fgl2 in endothelial cells is controlled by Ets-1 and Oct-1 and requires the presence of both Sp1 and Sp3 pdf
... AAA TGC GCC CGC CCT TTT AGA ACG CCT GAG TCA G GCG GCG GTG GC AAT GCG CCC GCC CTT TTC TG AAT GCG CCA GGT ACC TTC TG GAC TGT GAT GCA AAT GCG CCC GAC TGT GAT GCG GTA CCT CCC GCC CTT TTC TGG GAA CTC ... gain further insight into the regulation of the fgl2 promoter, the region between )11 9 to ) 41 bp, just upstream of the putative TATA box (Fig 4A), was subjected to systematic site-directed mutagenesis ... transcriptional start site at nucleotide 13 20 in AF0 25 817 as position +1 Although there is a second potential upstream TATA box at position ) 314 with respect to transcription initiation, the usage of...
- 13
- 525
- 0
Báo cáo khoa học: Protein aggregation and amyloid fibril formation prediction software from primary sequence: towards controlling the formation of bacterial inclusion bodies pot
... each hot-spot, the area of the aggregation profile above the HST, the total area (the HST being the zero axis) and the area above the HST of each profile peak identified as a hot-spot These areas ... cut-off (have numbers of expected contacts higher than the cut-off) and the size of the region is greater than or equal to the size of the sliding window used Optimum values for the cut-off (threshold) ... range from quite simplistic to quite complex The ability to form b-strands is a predominant feature in most works, either in the form of statistical propensities or in the form of structural stability...
- 8
- 415
- 0
Protecting New Health Facilities from Natural Disasters: Guidelines for the Promotion of Disaster Mitigation potx
... wind-resistant building codes in the region strive to protect the lives of those inside the building, not to ensure the continuity of the building’s operations.6 Both the architectural and the structural ... nonstructural elements (which account for about 80 percent of the total cost of the facility), it is estimated that incorporating mitigation elements to the construction of a new hospital accounts ... the structure, its components and protection systems, and certificates of compliance with project specifications Structural components Elements that are part of the resistant system of the structure,...
- 53
- 1,155
- 0
Báo cáo khoa học: A guide to taming a toxin – recombinant immunotoxins constructed from Pseudomonas exotoxin A for the treatment of cancer ppt
... Weldon and I Pastan 11 4 11 5 11 6 11 7 11 8 11 9 12 0 12 1 12 2 12 3 12 4 12 5 residues within domain III of Pseudomonas aeruginosa exotoxin A Biochemistry 35, 15 134 15 142 Armstrong S, Yates SP & Merrill ... substitution alters the target of the toxin from the membrane-associated heparin-binding epidermal-growth-factor-like growth factor [4] to the IL-2 receptor, redirecting its potent cytotoxicity toward ... against the inclusion of lysine residues in the protein sequence of the A fragment but not the B fragment of PE Because only the A fragment must traffic to the cytosol for activity, the lack of lysine...
- 18
- 528
- 0
Báo cáo khoa học: From meiosis to postmeiotic events: The secrets of histone disappearance potx
... on three distinct events that occur long before histone replacement itself but prepare chromatin for these dramatic transitions It is of note that the findings of many studies converge to show the ... chromatin than other H1 subtypes, and has less affinity not only for nucleosomal DNA but also for free DNA [ 15 ] It is therefore very tempting to hypothesize that waves of histone variants with the ... mediatation of their removal This reasoning led us to investigate the function of a testis-specific double-bromodomain factor, Brdt, which has the ability to interact with acetylated chromatin...
- 6
- 353
- 0
Báo cáo khoa học: "From RAGS to RICHES: exploiting the potential of a flexible generation architecture" pot
... waits for the finalise event of the first and then starts processing, the third waits similarly for the second to finalise etc Synthetic events allow modules to tell each other more explicitly that ... nostril DO NOT let the dropper touch the inside of your nose Keep your head tilted back for two to three minutes to help the drops run to the back of your nose Replace the top on the bottle Tilt ... Hold the dropper above your nose Then put the drops into your nostril The dropper must not touch the inside Keep your head tilted back for two to three minutes so that the drops run to the back...
- 8
- 368
- 0
Báo cáo Y học: Interaction of the GTS1 gene product with glyceraldehyde3-phosphate dehydrogenase 1 required for the maintenance of the metabolic oscillations of the yeast Saccharomyces cerevisiae pdf
... 5 -TTGGGATCCTTAAGCCTTGGCAACATATTC-3¢ 5 -GAAAACTGGATCCGACTTGTATGCTAAAGG-3¢ 5 -TAATAGGAATTCTGATCATTTTGTTTTGTG-3¢ 5 -AACAAGAATTCATGGTTAGAGTTGC-3¢ 5 -AGGAGCTCGAGTTAAGCCTTGGCAAC-3¢ 5 -AACTAACTAGTACTTGTATGCTAAAGG-3¢ 5 -TTGTGTGTGTTGGTGAAATATCAAACC ... 5 -GGAGAATTCGTTGGGCTGAGCTTCTGATCC-3¢ 5 -TTGGGATCCTTAAGCCTTGGCAACATATTC-3¢ 5 -CTTTGAATTCTGCTGTAACCCGTACATGCC-3¢ 5 -ATTAGAATTCGCGGCTAAAGTTAAGCATGC-3¢ 5 -GAAAACTGGATCCGACTTGTATGCTAAAGG-3¢ 5 -TTGGGATCCTTAAGCCTTGGCAACATATTC-3¢ ... 5 -TTGTGTGTGTTGGTGAAATATCAAACC AAGTTCTTGATGAATTTC-3¢ 5 -GTGTATTTTTCTTCGTTAACACCCATGACGAA CATTGGGGCGGTG-3¢ 15 Fig Determination of the binding site of Gts1p in the 97 C-terminal residues of GAPDH3...
- 10
- 410
- 0
straumann n. from primordial quantum fluctuations to the anisotropies of cmbr
... 14 1 14 1 14 5 14 6 14 9 15 3 15 8 16 0 16 0 16 2 16 7 17 0 17 1 17 4 18 1 18 4 19 0 A Random fields, power spectra, filtering 19 1 B Collision integral for Thomson scattering 19 3 C Ergodicity for ... received at the time to + ∆to , we obtain from the last equation to +∆to te +∆te dt = a (t) to te dt a (t) (27) For a small ∆te this gives ∆to ∆te = a(to ) a(te ) The observed and the emitted frequences ... equilibrium Since the chemical potentials of the leptons vanish, these quantities are only functions of the 25 temperature T According to the second law, the differential of the entropy S(V, T ) is given...
- 205
- 299
- 0
210. The change from day to night results the rotation of the Earth. a. change b. to c. results d. potx
... for the last two centuries that lightning was a form of electricity a It has b the last c was d a form > c 356 The intention of environmentalists is to protect the disappearing spotted owl with ... From 17 85 to 17 90, the capital of the U.S will be located in New York city a From b to c the d will be located > d 257 The water in the Great Salt Lake is at less four times saltier than seawater ... Because the committee was anxious to attend the celebration, the president dispensed to reading the minutes a Because the committee was anxious b the c to reading d minutes > c 2 91 The customer...
- 28
- 2,117
- 0
Journal of retailing and consumer services volume 19 issue 1 2012 modeling the effect of self efficacy on game usage and purchase behavior
... years 11 15 years Very Often 4 4 4 5 5 5 6 6 6 7 7 7 PU8 PU9 PU10 PU 11 PU12 PU13 PU14 4 4 5 5 6 6 7 7 PU 15 PU16 PU17 PU18 PU19 PU20 Expert SK1 Thinking about game from Q9, please answer the following ... subjected to multivariate normality testing Results show that the Mardia coefficient was greater than 15 , very much higher than the 3.0 cutoff advised by Wothke (19 93) Thereby, the Bollen–Stine bootstrap ... wish to ascertain the applicability of the results to other geographical areas Also, it could be argued that grouping the games together in terms of genre types is a limitation of the data analysis...
- 11
- 416
- 0
From Conflict to Peacebuilding The Role of Natural Resources and the Environment pdf
... Secretary-General to invite the International Committee of the Red Cross to report on activities undertaken by the Committee and other relevant bodies with regard to the protection of the environment in times ... institutions to assist the Government of National Unity and Transition in establishing efficient and transparent control of the exploitation of natural resources.” SCR 15 09/2003:93 The situation ... Report on the Prevention of Armed Conflict (20 01) : The United Nations should strengthen its capacity to help coordinate the international efforts of all actors to carry out structural prevention...
- 50
- 468
- 0
Báo cáo toán học: "Maximising the permanent of (0,1)-matrices and the number of extensions of Latin rectangles" docx
... follows The vertices of T (R, v) correspond to paths in G(R) which start at v Two vertices are adjacent if, of the two paths they correspond to, one is a maximal proper subpath of the other The root ... 1 10 0 1 0 1 1 1 0 1 0 0 1 1 0 0 0 Figure 1: A(R) for maximising R ∈ L(3, 7) 0 0 0 0 1 1 1 0 0 1 1 0 0 1 1 0 0 1 1 0 1 1 0 1 1 0 0 1 1 0 0 1 1 0 0 1 1 1 ... n) n\k 10 11 12 10 5J2 [32] D10 [1] J10 [0] − − 11 J3 ⊕ 2D4 (486) 4J2 ⊕ D3 (32) D 11 [1] J 11 [0] − 12 3J4 [13 824] 4J3 [12 96] 6J2 [64] D12 [1] J12 [0] 13 J5 ⊕ 2D4 ∗ ( 15 756 0) 2J4 ⊕ D5 ∗ ( 253 44) 3J3...
- 20
- 256
- 0
Báo cáo y học: "Sphingosine-1-phosphate promotes the differentiation of human umbilical cord mesenchymal stem cells into cardiomyocytes under the designated culturing conditions" pdf
... micropipette tip to help separate the cell sheet from the wall of the culturing well Gentle squeezing of culture fluid against the confined cell sheet using the micropipette tip was also helpful to ... subsequently purged with nitrogen for about 10 mol% of the total (NIPAAm + HPM + TMSPM) of AIBN was added into the mixture solution (0.0 319 g) The mixture was then kept under heating and stirring at ... on these results, we speculate that S1P could have a potential to affect biology of MSCs derived cardiomyocytes Thus, the aims of the present study are two folds; firstly, to determine whether...
- 9
- 262
- 0
báo cáo khoa học: " The Arabidopsis pop2-1 mutant reveals the involvement of GABA transaminase in salt stress tolerance" pps
... of the start codon of POP2 (At3g22200) using the forward primer 5- GGGGACAAGTTTGTACAAAAAAGCAGGCTGAGTTCACTAAATTCTCCTGAC-3 and the reverse primer 5GGGGACCACTTTGTACAAGAAAGCTGGGTGCGATAACGACCATTTTCTCCTAC-3 ... shoots and roots of WT and pop2 -1 after days of treatment with 15 0 mM NaCl A targeted analysis of GABA content in pop2 -1 mutant and its WT was first performed and showed that mutant constitutively ... Renault et al BMC Plant Biology 2 010 , 10 :20 http://www.biomedcentral.com /14 71- 2229 /10 /20 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 an intricate relationship of cold-regulated...
- 16
- 231
- 0
Báo cáo y học: "Egress of HSV-1 capsid requires the interaction of VP26 and a cellular tetraspanin membrane protein" doc
... http://www.virologyj.com/content/7 /1/ 156 ments were against the nucleotides 17 9 to 208 and 55 3 to 58 2 of the CTMP-7 gene respectively: 5' -GGATCCCGCAGGCCAAAGACAACAATAGT GGTGCCAGTCAAGAGCTGGCACCACTATTGTTG TCTTTGGCCTGtcgtcagctcgtgccgtaag ... TCTTTGGCCTGtcgtcagctcgtgccgtaag TGAAACTAGTTACCAGATCATAACAACCCTCA AGAGGGTTGTTATGATCTGGTAACTAGTTTCA TTTTTTCTAGA-3' was inserted into pGE -1 to be as pGE-CTMP In addition, a scrambled interfering RNA was used as the ... -3' and 5' - TCGTTGCCGTCGTCGTCCTC -3', 5' AGGCATGCCCATTGTTATCTG -3' and 5' - GAGACAATCGCGAACATCTAC -3', 5' - ATTCCACCCGCA TGGAGTTC -3' and 5' - CGGTGATGTTCGTCAGGACC -3', respectively Reactions were...
- 12
- 302
- 0
Báo cáo y học: "HIV-1 integrase modulates the interaction of the HIV-1 cellular cofactor LEDGF/p75 with chromati" pptx
... in their binding to chromatin Due to the central role of chromatin binding in the HIV -1 cofactor activity of LEDGF/p 75, it is expected that the HIV -1 cofactor activity of LEDGF/p 75 ΔPWWP mutant ... indicated that the LEDGF/p 75- HIV -1 integrase interaction is very stable, resisting the treatment with 50 0 mM NaCl The effect of higher salt concentrations on the stability of this complex was not ... fibroblasts as a result of the saturation of the nuclear import pathway responsible for the nuclear localization of these mutants [12 ] Different from LEDGF/p 75 WT that enters to the nucleus via the...
- 14
- 181
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25