from an environmental risk factor to a reliable

... evaluation Coronary angiogram data Angiographic data was retrieved from the Mayo Clinic coronary care unit database Mayo Clinic cardiologists who performed the study and read each angiogram were not ... angina and are significantly expanded in patients with unstable angina (P = 0.009) Patients with RA and CAD resemble patients with plaque instability and differ from those with stable angina (P ... Characteristics of cases with RA and CAD Table includes characteristics of the patients with RA Average age at onset of RA was 55 years and the average disease R986 Arthritis Research & Therapy...

Ngày tải lên: 09/08/2014, 06:23

... infection, and a favorable response to antimicrobial therapy Data registration and statistical analysis Data were collected daily by one of the authors (PY) and entered into an SPSS database (SPSS Data ... study and acquisition and analysis of data, and drafted the manuscript TA-K, JL, and HS participated in the design of the study and the analysis of data and drafted the manuscript PO participated ... analysis was used to evaluate the odds ratios (ORs) with 95% CI Two parallel multivariable models were built: an APACHE score and age-adjusted model; and a SOFA score and age-adjusted model All...

Ngày tải lên: 12/08/2014, 23:23

... tolerance and the variance inflation factor Variables associated with bacteremia in univariate analysis were included in a multivariate analysis for identification of independent variables after adjustment ... Respiratorias), Antonio Macor (Amedeo di Savoia Hospital, Torino, Italy), Emilpaolo Manno (Maria Vittoria Hospital, Torino, Italy), Rafael Mañez (Bellvitge University Hospital, Barcelona, Catalonia), ... to A baumannii and Klebsiella pneumoniae showed bacteremia due to A baumannii was significantly more frequent secondary to NP than bacteremia due to K pneumoniae [27] Jamulitrat and colleagues...

Ngày tải lên: 14/08/2014, 07:21

... forehead was bleeding I quickly telephoned for the ambulance After a while the ambulance came and took John to the hospital I was miserable because John was in hospital with a bleeding forehead ... gave in to him and he was happy He played with the skate board and while he was riding on it, he accidentally tripped over a big piece of stone To my horror, he knocked himself against the wall ... parents came home, I told them what had happened Together we went to the hospital to visit John John was not asleep and his parents were there John apologized for being naughty and promised to...

Ngày tải lên: 22/07/2014, 03:21

... Pratschke J: Complication rate of pancreas retransplantation after simultaneous pancreas-kidney transplantation compared with pancreas after kidney transplantation Transplant Proc 2007, 39:563-564 ... fistula in a pancreatorenal transplant patient Ann Emerg Med 2003, 42:587-591 15 Semiz-Oysu A, Cwikiel W: Endovascular management of acute enteric bleeding from pancreas transplant Cardiovasc Intervent ... think that in renal and pancreatic transplant patients with gastrointestinal bleeding of obscure origin, even some years after transplantation after years, there should be a high suspicion for arterioenteric...

Ngày tải lên: 11/08/2014, 02:22

... design, analysed and interpretated data, and drafted and revised the article RLL, PVdN, MLM, EH, PD and JD conceived of the design, analysed and interpretated data, and drafted and revised the article ... patients? Nephrol Dial Transplant 1996, 11:1250-1255 Kanagasundaram NS, Paganini EP: Critical care dialysis: a gordian knot (but is untying the right approach?) Nephrol Dial Transplant 1999, 14:2590-2594 ... renal replacement therapy in critically ill patients Nephrol Dial Transplant 2001, 16(suppl 5):67-72 Mehta R, Mcdonald B, Gabbai F, Pahl M, Pascual M, Farkas A, Kaplan RM: A randomized clinical...

Ngày tải lên: 14/08/2014, 07:21

... individuals demand more from their cardio-respiratory and musculoskeletal systems [22] It is known that more than 50% of adult Americans have a BMI equal to or greater than 25 [23] Although there are ... isolated and can be read Step four involves collating the evidence to answer the question In searches one may find answers that were not known to exist, and information that may challenge an already ... controversial, Table may lead to a further refinement of risk of osteoarthritis and low back pain based solely on BMI Limitations of obesity as a risk factor for low back pain A significant difficulty...

Ngày tải lên: 13/08/2014, 13:22

... whether aDrs has any antibacterial or cytotoxic activity We discovered that aDrs can form amyloid-like aggregates at acidic pH We tested the antibacterial or cytotoxic activity of these aggregates ... dodecylphosphocholine may have led to an overestimated value for the helical fraction of up to 20% (Fig 1) Antibacterial and cytotoxic activity of soluble aDrs We tested the antibacterial activity of aDrs against ... features of cytotoxicity J Biol Chem 279, 31374–31382 34 Gharibyan AL, Zamotin V, Yanamandra K, Moskaleva OS, Margulis BA, Kostanyan IA & Morozova-Roche LA (2007) Lysozyme amyloid oligomers and fibrils...

Ngày tải lên: 23/03/2014, 04:20

... compensation The mai-baap manager The Indian manager has a unique role to play, that of mai-baap (mother-father, that is, parents) Many team members also expect the manager to play almost a parental role ... corporate, as well as a startup He maintains a blog at http://pankajghanshani.com, and you can follow him on Twitter at @PankajGhanshani and find him on Linkedin at http://www.linkedin.com/in/pankajghanshani ... Coordinator Vishal Bodwani Proofreader Aaron Nash Kishore Shenoi Pankaj Ghanshani Indexer Tejal Daruwale Acquisition Editors Amey Kanse Kartikey Pandey Lead Technical Editor Kartikey Pandey Technical...

Ngày tải lên: 23/03/2014, 13:20

... Company of America American Can American Telephone & Telegraph American Tobacco Anaconda Bethlehem Steel Chrysler DuPont Eastman Kodak Exxon General Electric General Foods General Motors Goodyear ... removed from the financial world than Aidan’s Martha has taught courses on ancient and medieval gender and sexuality at Rutgers and has edited one published book related to her specialty.1 Since marrying ... this approach CERTAIN ASSUMPTIONS We are going to assume that the reader already has a basic understanding of how the stock market works, how a stock transaction is carried out accessing an exchange...

Ngày tải lên: 03/05/2014, 12:43

... including accounting facilities, purchasing and travel arrangements and travel insurance for its staff A rating of Fully Satisfactory (4) for the performance of the Australian agency is considered appropriate ... considered as appropriate 5: Best Practice; 4: Fully Satisfactory; 3: Satisfactory Overall; 2: Marginally Satisfactory; 1: Weak 4.0 Performance and Outcomes 4.1 Assessment of Performance Against Objectives ... are now proceeding to commercialisation Sustainability is rated as Fully Satisfactory (4) 5: Best Practice; 4: Fully Satisfactory; 3: Satisfactory Overall; 2: Marginally Satisfactory; 1: Weak...

Ngày tải lên: 22/06/2014, 13:20

... present study was conducted to evaluate acetaldehyde found as a direct component of alcoholic beverages as an additional cancer risk factor to acetaldehyde formed from ethanol Our aim was to provide ... Monakhova: Short-term salivary acetaldehyde increase due to direct exposure to alcoholic beverages as an additional cancer risk factor beyond ethanol metabolism Journal of Experimental & Clinical Cancer ... enzymatic assay for approximately half of the samples to be analyzed, because of its lower costs and faster analysis times Analytical procedure The determination of acetaldehyde in saliva samples...

Ngày tải lên: 10/08/2014, 10:20

... cesarean: a case series and review of the literature Am J Perinatol 2009, 26(10):739-744 Kurdoglu M, Kolusari A, Yildizhan R, Adali E, Sahin HG: Delayed diagnosis of an atypical rupture of an ... followed-up and managed the patient, and determined the medical significance SM and TK wrote the manuscript TK and NS revised the manuscript NS and MS provided important suggestions regarding medical ... diagnosis Page of Abbreviations CT: computed tomography; CTG: cardiotocography Author details Department of Obstetrics and Gynecology, Jichi Medical University, Tochigi, Japan 2Jichi Perinatal...

Ngày tải lên: 10/08/2014, 23:20

... research (as primary investigator, co-investigator in any cancer-related research study), were obtained from the PEBC database Data on clinicians' beliefs about and attitudes towards CPGs were gathered ... characteristics and messages and the CPG development process, actual and perceived facilitators and barriers to implementation, and factors related to norms and the practice context [2,8-15] For example, ... established cancer CPG program; and evaluate how clinician characteristics and clinician beliefs and attitudes are associated with these trends Methods Context The Cancer Care Ontario Program...

Ngày tải lên: 11/08/2014, 05:21

... consultation and model adaptation to suit team)3 • Change in approach to addressing SNAP risk factors • Views about continuation of risk factor management as part of professional role1/team or ... shaping clinicians' intervention practices Risk factor management practices Clinicians' risk factor management practices varied according to the approach adopted for assessing lifestyle risk factors ... team or service2 • Approach to addressing SNAP risk factors (client case example)1 • Work priority to address SNAP risk factors1 • Confidence to address SNAP risk factors1 • Barriers and enablers...

Ngày tải lên: 11/08/2014, 05:21

... Mauritania, Mauritius, Mozambique, Namibia, Niger, Nigeria, Reunion, Rwanda, Sao Tome and Principe, Senegal, Seychelles, Sierra Leone Somalia, South Africa, Sudan, Swaziland, Tanzania, Togo, Uganda, Zambia, ... exposure to an urban environment in Cameroon in relation to obesity and other cardiovascular risk factors, found that urbanization is associated with a drastic decrease in physical activity and changes ... NMDI, Baldé MD, Barry IS, Kaba L, Diallo MM, Kaké A, Camara A, Bah D, Barry MM, Sangaré-Bah M, Maugendre D: Diabetes and impaired fasting glucose in rural and urban populations in Futa Jallon...

Ngày tải lên: 11/08/2014, 14:21

... research (as primary investigator, co-investigator in any cancer-related research study), were obtained from the PEBC database Data on clinicians' beliefs about and attitudes towards CPGs were gathered ... characteristics and messages and the CPG development process, actual and perceived facilitators and barriers to implementation, and factors related to norms and the practice context [2,8-15] For example, ... established cancer CPG program; and evaluate how clinician characteristics and clinician beliefs and attitudes are associated with these trends Methods Context The Cancer Care Ontario Program...

Ngày tải lên: 11/08/2014, 16:20

... internal standardization (primers sequences as follow: actinF: 5’CACAGATCATGTTTGAGACCTT3 ‘ actinR: 5’CATCACAATACCAGTGGTACG3’, primers M1F: 5’GGCTAAAGACAAGACCAATCCTG3’ and M1R: 5’GTCCTCGCTCACTGGGCAC3’ ... from first strand cDNA with rTaq polymerase (TAKARA, Japan) and primers chCypA-F: 5’ATGAATTCGGATGGCCAACCCCGT CG-3’ and chCypA-R: 5’TGCTCGAGTTACGAGAG CTGCCCGC-3’ The PCR amplified chCypA genes were ... T, Takahashi T, Miyamoto D, Hidari KI, Guo CT, Ito T, Kawaoka Y, Suzuki Y: Human trachea primary epithelial cells express both sialyl(alpha2-3)Gal receptor for human parainfluenza virus type and...

Ngày tải lên: 11/08/2014, 21:21