franchising as a growth strategy

... Piedras Feria 142 The creative economy and the development possibilities in Argentina Facundo Solanas 160 Creative economy as a strategy for Jamaica and the Caribbean growth and wealth generation ... urban socioeconomic set, based on local specifics, such as Guaramiranga, with its Jazz and Blues Festival, and Paraty, with FLIP (the International Literary Festival of Paraty) as examples (read ... it has not been established as a second language; c) skilled human resources; d) communications infrastructure in large areas of Africa, of developing Asia, and of several countries in Latin America,...

Ngày tải lên: 14/02/2014, 08:20

... is as likely (perhaps inherently) at fault as the methodology itself Qualitative research as preparation - As mentioned above, qualitative research has a long standing history as an exploratory ... Administrative Science Quarterly article titled 'Qualitative data as an attractive nuisance' that research based upon case study was unlikely to transcend story-telling Is case study a valid research ... research process is very important if other researchers are to be able to repeat a research programme: It is for this reason that researchers like Yin are especially adamant that a case database...

Ngày tải lên: 20/02/2014, 11:20

... hyperphosphorylation occurs because of an imbalance in the activity of tau kinases and phosphatases [3] One particular tau kinase pertinent to metal dyshomeostasis in AD is glycogen synthase kinase-3 ... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... metal dyshomeostasis in all aspects is clear In the AD affected brain, metal dyshomeostasis is evident in the form of a substantial increase in the levels of extracellular metals and a decrease...

Ngày tải lên: 07/03/2014, 10:20

... plasmid pcDNA3.1HHR2 3A by PCR The 5' primer used was 5'ATCCAAGACGGAATTCACGCCGCAGGAGAAAGAAGCTATAG-3'; the 3' primer for the APOPEC3G-UBA2 fusion was 5'-ATCGTACTCGAAGCTTCTAACTCAGGAGGAAGTTGGCAG-3'; ... the E plasmid was 5'-ATCCAAGACGGAATTCCTAGAACTCGTTTTCCTGATTCTGGAG-3' and the 3' primer used for the U and M plasmid was 5'-ATCCAAGACGGAATTCGTTTTCCTGATTCTGGAG-3' The UBA2 gene fragment was amplified ... essential for Vif function J Biol Chem 2005, 280(19):18573-18578 Shirakawa K, Takaori-Kondo A, Kobayashi M, Tomonaga M, Izumi T, Fukunaga K, Sasada A, Abudu A, Miyauchi Y, Akari H, Iwai K, Uchiyama...

Ngày tải lên: 13/08/2014, 05:21

... ALD, aldolase ALT, alanine transaminase AKT, protein kinase B AML, acute myeloid leukemia AMP, adenosine monophosphate AMPK, AMP activated protein kinase ASCT, amino acid transporter ATP, adenosine ... diphosphate ; ALD, aldolase ; ALT, alanine aminotransferase; ATP, adenosine triphosphate; CS, citrate synthase; ENO, enolase; FA, fatty acids; FAD, flavin adenine dinucleotide; FASN, fatty acid synthase; ... into acetyl-CoA and oxaloacetate by ATP citrate lyase (ACL) Fatty acid synthesis starts with acetyl-CoA carboxylase (ACC) Barbara Julieta Chaneton, 2014 34 converting acetyl-CoA to malonyl-CoA, and...

Ngày tải lên: 22/12/2014, 20:36

... clinically important Fabry disease-associated a- galactosidase A variants (causing another lysosomal storage disease) were shown to be folding and trafficking mutants [16] before this was explored as ... ameliorate Gaucher disease 19 Fan JQ, Ishii S, Asano N & Suzuki Y (1999) Accelerated transport and maturation of lysosomal alpha-galactosidase A in Fabry lymphoblasts by an enzyme inhibitor Nat Med ... G328R variant, meaning that a heart transplant was no longer required [17] An active-sitedirected pharmacologic chaperone for a- galactosidase A discovered by Jian-Qiang Fan and developed by Amicus...

Ngày tải lên: 18/02/2014, 16:20

... enough to allow comparative advantages to last for extended periods The advent of technology as a major tradeable asset has radically changed the dynamics of trade among nations What the centuries’ ... productivity is easier to calculate, it is available much faster than MFP and has the added advantage of being simpler and hence more easily understood Thus, the media and the policy infrastructure ... While ARRA was certainly a major stimulus program, only a modest share of the total funding was directed at investment Specifically, $105.3 billion was allocated to traditional economic infrastructure...

Ngày tải lên: 08/03/2014, 16:20

... Bazaar), and mangrove areas (Sunderbans) are located in the region Its biodiversity is unmatched (Sinharaja, Chitwan) Home to marvels such as the Taj Mahal, Ajanta, Sigiriya, Timpu, and Taxila, ... collaborations in tourism planning, promotion and development In South Asia, the main regional organization, South Asian Association for Regional Cooperation (SAARC) has also identified tourism as ... Chaminda Hettiarachchi as the Sri Lankan expert wrote the chapter on South Asia a tourism Orbit: A Regional Tourism Strategy The book was recently released in Kathmandu, Nepal and the first copy was...

Ngày tải lên: 19/03/2014, 00:20

... (e.g Graham and Harris [19]; Mason, Harris and Graham [18]; Harris, Graham and Mason [20]; Chalk, Hagan-Burke and Burke [21]) Information collected at the earlier stage will be analyzed and taken ... strategies already taught Strategy generalization and maintenance continue to be planned The teacher and students evaluate the effectiveness of strategy use and performance collaboratively Revisions can ... in language teaching and learning, Language Teaching 40 (2006) 21 [6] D Little, Language learner autonomy: Some fundamental considerations revisited, Innovation in Language Learning and Teaching...

Ngày tải lên: 28/03/2014, 11:20

... the variation in ST was large, and hence approximately half of the subjects terminated the tests before 50% of the maximum time had passed Outcome data were analysed using a slope calculated as ... ratings of motion sickness as often as possible, it is always a trade-off between asking many or few questions to obtain a valid measurement of the perceived state The NoFix slope increased as ... in a driving simulator that was in accordance with the vestibular and visual information perceived [22] This visual-based artificial horizon reduced perceptual errors and also reduced balance...

Ngày tải lên: 19/06/2014, 08:20

... represents, above all, a favoured area for leisure and relaxation Inhabitants of mountain regions see it as protection against natural dangers and as a tourist attraction Forest owners, farmers, and ... in accordance with the demands and options of their times (Mantel 1990) As early as in 1295, a local rule of Landau (Palatina) provided that wood cut in the area be available for the local inhabitants ... were applied over increasingly large areas In regions where oak and beech forests dominated, the coppice-with-standards system was a typical example of systematic management on a large scale This...

Ngày tải lên: 07/08/2014, 03:22

... according to recommendations that are based on the best available research Numerous population-based studies in Canada, Australia, the United Kingdom and United States demonstrate low compliance ... Designated Research Team Approach to building research capacity in primary care BMC Fam Pract 2008, 9(1):37 Cooke J: A framework to evaluate research capacity building in health care BMC Fam Pract ... 6:44 Haas M: Health services research in Australia: an investigation of its current status J Health Serv Res Policy 2004, 9(Suppl 2):3-9 Arnold LK, Alomran H, Anantharaman V, Halpern P, Hauswald...

Ngày tải lên: 11/08/2014, 05:21

... support, audit/feedback as a clinical information system, and organizational change to achieve an appropriate delivery system design These activities are complemented by academic-detailing and social ... Disease- Fiscal Year 2002 Palo Alto, CA, Center for Quality Management in Public Health Veterans Health Administration Department of Veterans Affairs; 2003:1-68 Bozzette SA, Ake CF, Tam HK, Chang ... original mission of the HIV/ Hepatitis QUERI Center was to increase access to, and uptake of, evidence-based HIV care, and to improve the care that veterans receive for their disease and associated...

Ngày tải lên: 11/08/2014, 05:22

... according to recommendations that are based on the best available research Numerous population-based studies in Canada, Australia, the United Kingdom and United States demonstrate low compliance ... Designated Research Team Approach to building research capacity in primary care BMC Fam Pract 2008, 9(1):37 Cooke J: A framework to evaluate research capacity building in health care BMC Fam Pract ... 6:44 Haas M: Health services research in Australia: an investigation of its current status J Health Serv Res Policy 2004, 9(Suppl 2):3-9 Arnold LK, Alomran H, Anantharaman V, Halpern P, Hauswald...

Ngày tải lên: 11/08/2014, 16:20

... support, audit/feedback as a clinical information system, and organizational change to achieve an appropriate delivery system design These activities are complemented by academic-detailing and social ... Disease- Fiscal Year 2002 Palo Alto, CA, Center for Quality Management in Public Health Veterans Health Administration Department of Veterans Affairs; 2003:1-68 Bozzette SA, Ake CF, Tam HK, Chang ... original mission of the HIV/ Hepatitis QUERI Center was to increase access to, and uptake of, evidence-based HIV care, and to improve the care that veterans receive for their disease and associated...

Ngày tải lên: 11/08/2014, 16:21

... heart catheterization A balloontipped pulmonary arterial catheter was advanced to the pulmonary artery for measurement of pulmonary arterial pressure (PAP) and PWP In addition, a plastic catheter ... considered adequate if the patient was able to expectorate at least mL of sputum Statistical analysis All values are presented as mean (SD) Multiple comparisons were performed by one-way analysis of variance ... Endothelial cell death and decreased expression of vascular endothelial growth factor and vascular endothelial growth factor receptor in emphysema Am J Respir Crit Care Med 2001, 163:737-44 Kanazawa...

Ngày tải lên: 12/08/2014, 15:20

... Univariate regression analysis was used to assess factors associated with de-escalation All variables with a P-value < 0.1 determined by univariate regression model were entered into a multivariate ... coagulase-negative staphylococci; Enterobacteria producing an extended-spectrum beta-lactamase or producing a cephalosporinase; and nfGNB resistant to piperacillintazobactam, ceftazidime, or imipenem-cilastatin ... implementation of a de-escalation directed protocol for antibiotic management compared to a more liberal strategy with no de-escalation may answer this question Conclusions As part of a global management...

Ngày tải lên: 14/08/2014, 07:21

... were as follows: EGFR gene forward primer, 5' -CGAGGGCAAATACAGCTTTG -3'; backward primer, 5'- CCTTCGCACTTCTTACACTTG -3'; probe 5'FAM-ACGCCGTCTTCCTCCATCTCATA GCTAMRA3' Thermal cycler parameters ... maintenance, and spread of malignant tumors.[30] The reduction of EGFR may lead to a failure in downstream signal cascades including PI3-K, RAS-RAF-MAPK P44/P42, and protein kinase C pathway, and ... formazan crystals were solubilized by 150 µl of DMSO The absorbance of each well was measured in a microplate reader at 490 nm (A4 90) The percentage of cell growth was calculated by comparison...

Ngày tải lên: 14/08/2014, 19:22

... spatial management strategies such as the establishment of marine protected areas (MPAs) (Gardmark et al 2006) Thus, understanding how growth rate varies across time and space is fundamental ... showed that the mean and variance of traditional biological measurements were higher in MPAs than in non-MPAs, whereas IGF1 levels were also more variable in MPAs than in non-MPAs but mean levels ... multivariable analysis of variance (ANOVA) (PERMANOVA, SUITABILITY OF IGF1 253 FIGURE Location of lingcod collections near Friday Harbor inside and outside marine protected areas (MPAs) Area names are as...

Ngày tải lên: 04/09/2015, 17:15

... world Tilapia production were Nile Tilapia Production of Tilapia in Vietnam has been increasing year by year; the farming area has been expanded In 2009, the area of tilapia reached 29,717 ha, production ... Tilapia 30 REFERENCES Aguilera-Morales, M., M Casas-Valdez, Carrillo-Dominguez, S., Gonzalez-Acosta, B and Perez-Gil, F., in 2005, chemical composition and microbiological assays of marine algae ... Essential fatty acids of (Tilapia nilotica) Mem Fac Fish., Kagoshima Univ 31: 201-204 Teshima, S., A Kanazawa, and Y Uchiyama 1985 Optimun protein levels in caseingelatin diets for Tilapia nilotica...

Ngày tải lên: 18/11/2015, 19:54