form a work group for home projects

Work environment as a motivating factor for self  improvement of english A case study of projects in cảe internatinal in viet Nam

Work environment as a motivating factor for self improvement of english A case study of projects in cảe internatinal in viet Nam

... CARE International in Vietnam Another reason is that the author has been a part of the “natural setting” She has been working in CARE International in Vietnam for one year and a half This case ... University of East Anglia, pp.45-61 Australian National Training Authority, (2003), What makes for good workplace learning, National Centre for Vocational Education Research Ltd Baloto, F (1996), ... an illustration, education and learning is a life-long process and in any environment, even after graduation or not in an educational setting, learning is always taking place and motivation for...

Ngày tải lên: 04/08/2015, 09:42

11 443 0
Tài liệu Health education: A practical guide for health care projects docx

Tài liệu Health education: A practical guide for health care projects docx

... resources available) Using theatre can also be beneficial, as shown by a study carried out in 2001 in a rural area in India The Kalajatha theatre was used there as a means of IEC on Malaria Local artists ... for all human beings, and on the other hand, a constantly questioned adaptation of humans to an environment in perpetual transformation (Ottawa Charter); – “The mental and physical state relatively ... what has already been done, and to avoid making certain mistakes again 1 / How should information be gathered to establish a Situation Analysis? qualitative approach, which will help to more accurately...

Ngày tải lên: 14/02/2014, 09:20

53 563 1
140 CHARACTERS A Style Guide for the Short Form

140 CHARACTERS A Style Guide for the Short Form

... Commas are a favor to the reader, not always necessary Eliminate personal pronouns When all else fails, invent a tag .A great tag works as the target of a search, and also declares its place within ... status appliances, and social networks has created an audience that both is voracious and has a deficit of attention We as readers define the short form within the limits of our own attention Material ... extremely basic, and only allowed a search of real names or usernames, not the messages themselves Twitter had been operational for more than a year when management decided to create an account...

Ngày tải lên: 19/02/2014, 21:22

210 3,1K 0
Tài liệu Báo cáo khoa học: "A Multimodal Interface for Access to Content in the Home" pdf

Tài liệu Báo cáo khoa học: "A Multimodal Interface for Access to Content in the Home" pdf

... underlying database of movie information is stored in XML format When a new database is available, a Grammar Compiler component extracts and normalizes the relevant fields from the database These are ... overall 66% sentence accuracy and 76% word accuracy Task completion: Since participants had to record the task answers on a paper form, task completion was calculated by whether participants ... the evaluation Prior studies have primarily conducted qualitative evaluation with small groups of users (5 or 6) A quantitative and qualitative evaluation was conducted examining the interaction...

Ngày tải lên: 20/02/2014, 12:20

8 586 0
Báo cáo khoa học: Identification of a novel binding site for calmodulin in ammodytoxin A, a neurotoxic group IIA phospholipase A2 docx

Báo cáo khoa học: Identification of a novel binding site for calmodulin in ammodytoxin A, a neurotoxic group IIA phospholipase A2 docx

... CAAATACaAgCGGGtGAACGGGGCTATCGTCTGTGaAAAAGGC GGAATTCGCgGCcGCCtTGTCACACTCACAAATCCGATTCTC GGGCAAGCTTGCgGCcGCAATCTGCTTTCGAcAGAATCTGAAcACATAttcgAAAAAGTATATGC GGGCAAGCTTGCgGCcGCAATCTGCTTCCGAcAGAATCTGAAcACATACAgCTATATATATAGG ... 2a+ 2b+ 2– 3+wt 3+YIRN 3– TAATACGACTCACTATAGGGAGACCACAACGGTTTCC GGGCaagcTTCCCCGTCTCCtCCAGGATCATCtTCCCG GGGCAAgcttgCTaTTcCCTCCTACTCCTcTTACGGATGCTACTGCGGCtgGGGGGG GACTGCAaCCCCAAAtCGGACAG CAAATACaAgCGGGtGAACGGGGCTATCGTCTGTGaAAAAGGC ... GGGCAAGCTTGCgGCcGCAATCTGCTTCCGAcAGAATCTGAAcACATACAgCTATATATATAGG GGAATTCTGCAGTTAGCATTTgagCTCtccCTTGCACAAgAAGTCCGG Ó FEBS 2003 3020 P Prijatelj et al (Eur J Biochem 270) Vista, CA), digested with BamHI/HindIII (fragment 1, 60...

Ngày tải lên: 17/03/2014, 03:20

8 401 0
Defining Incident Management Processes for CSIRTs: A Work in Progress pdf

Defining Incident Management Processes for CSIRTs: A Work in Progress pdf

... department and instead see incident management as a distributed capability Just like a CSIRT, an incident management capability can take many forms It can be a set of comprehensive policies and ... organization, including the CSIRT, as well as across multiple organizations such as contractors and service providers • A capability for providing incident management activities can take many forms; ... that are not being done For example, if configuration management, vulnerability scanning, and security awareness training are already being done by an organization’s IT department, it may be appropriate...

Ngày tải lên: 23/03/2014, 23:21

249 475 0
A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx

A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx

... for their assistance with this study This work was supported by a grant from the Marian Chace Foundation to Madeleine Hackney and a grant from the American Parkinson Disease Association to Gammon ... of balance, because the partner may provide helpful sensory information and stabilizing support that leads to improved balance and gait Argentine tango ‘steps’ are themselves composed of balance ... Scale (Lawton 1975) Balance was evaluated using the Functional Reach (Duncan et al 1990) and One Leg Stance Test (Vellas et al 1997) Walking velocity was assessed by tracking a reflective marker...

Ngày tải lên: 28/03/2014, 20:20

19 649 0
Báo cáo khoa học: "A Logical Basis for the D Combinator and Normal Form in CCG" pptx

Báo cáo khoa học: "A Logical Basis for the D Combinator and Normal Form in CCG" pptx

... Combinatory Categorial Grammar In Proceedings of EMNLP-2006 Mark Steedman and Jason Baldridge To Appear Combinatory Categorial Grammar In Borsley and Börjars (Borsley and Börjars, To Appear) Mark ... Motivation for D CCG is only partially associative Here, we discuss several situations which require greater associativity and thus cannot be given an adequate analysis with CCG as standardly ... present an alternate formulation of Eisner NF with Baldridge’s (2002) CTL basis for CCG This formulation allows us to derive the D-rules as before, and does so in a way that seamlessly integrates...

Ngày tải lên: 31/03/2014, 00:20

9 360 0
Business and Economics Q Manual A student guide for producing quality work on time ppt

Business and Economics Q Manual A student guide for producing quality work on time ppt

... used n the way data and information is integrated, analysed and critiqued n the way data and information is used as evidence in addressing issues and topics n the way data and information is presented ... world: Latin America and Carribean (R 1), South Asia (R 2) and Sub-Saharian Africa (R 3) The analysis indicates that the infectious disease situation in Sub-Saharian Africa is much worse than that ... informal and formal register Colloquial Colloquial or spoken or spoken language language is not suitable is not suitable Figure 7:7: Informal and formal register Figure Informal and formal register...

Ngày tải lên: 02/04/2014, 05:21

116 417 0
mac toys 12 cool projects for home, business and entertainment (digital lifestyle)

mac toys 12 cool projects for home, business and entertainment (digital lifestyle)

... offering a lot of X10 hardware and two different Mac software applications, SmartHome.com has a good deal of information about X10 technology, as well as ideas for home automation projects SmartHome.com ... bought his first Mac in 1984, and soon began writing about them A former staff editor for MacUser magazine, John now writes about Mac hardware and software for CNET.com and for Mac magazines His books ... TV and in movies Macs are also used for accounting and finance, marketing and sales, data management, and other important though less-than-exciting activities In fact, time has also proven that...

Ngày tải lên: 01/06/2014, 09:15

387 585 0
the eq difference a powerful program for putting emotional intelligence to work

the eq difference a powerful program for putting emotional intelligence to work

... don’t always end up as successful as Jack—what’s different about Jack?) His father’s parting message was, “Always act as a gentleman.” These words, spoken decades ago, called Jack to develop a sense ... Washington D.C Special discounts on bulk quantities of AMACOM books are available to corporations, professional associations, and other organizations For details, contact Special Sales Department, ... Performance Intellect has proven invaluable to our success in business Financial decisions based on analyzing details, sound strategies based on facts and data, and processes and procedures based...

Ngày tải lên: 03/06/2014, 01:01

299 492 0
Báo cáo hóa học: " Research Article A New Method for Least-Squares and Minimax Group-Delay Error Design of Allpass Variable Fractional-Delay Digital Filters" pdf

Báo cáo hóa học: " Research Article A New Method for Least-Squares and Minimax Group-Delay Error Design of Allpass Variable Fractional-Delay Digital Filters" pdf

... ignored for the iterative method in (23), which will yield satisfactory results Equation (23) can be further represented in a quadratic form as β= ak − ak−1 ak When β is small enough, for example, ... International Symposium on Circuits and Systems, pp 2641–2645, May 1998 [7] T I Laakso, V V¨ lim¨ ki, M Karjalainen, and U K Laine, a a “Splitting the unit: delay tools for fractional delay filter ... IEEE International Symposium on Circuits and Systems, pp 434–437, Sydney, Australia, May 2001 [17] C C Tseng, “Eigenfilter approach for the design of variable fractional delay FIR and all-pass filters,”...

Ngày tải lên: 21/06/2014, 07:20

10 490 0
Báo cáo toán học: "A Combinatorial Formula for Orthogonal Idempotents in the 0-Hecke Algebra of the Symmetric Group" potx

Báo cáo toán học: "A Combinatorial Formula for Orthogonal Idempotents in the 0-Hecke Algebra of the Symmetric Group" potx

... have a linear basis for their 1-spaces as desired, such that the union of these two bases form a basis for their parent’s 1-space Then the union of all such bases gives a basis for the 1-space ... Coxeter groups in [3] A more general approach to the representation theory can be taken by approaching the 0-Hecke algebra as a monoid algebra, as per [6] The main results are reproduced here for ease ... elements, and that the 0-Hecke algebra has dimension N! as a vector space Additionally, the length of a permutation is the same as the length of the associated H0 (SN ) element We can obtain a parabolic...

Ngày tải lên: 08/08/2014, 12:23

20 306 0
báo cáo khoa học: "Clinical relevance of "withdrawal therapy" as a form of hormonal manipulation for breast cancer" doc

báo cáo khoa học: "Clinical relevance of "withdrawal therapy" as a form of hormonal manipulation for breast cancer" doc

... 3d&tabid=2341] doi:10.1186/1477-7819-9-101 Cite this article as: Agrawal et al.: Clinical relevance of “withdrawal therapy” as a form of hormonal manipulation for breast cancer World Journal of ... datasets and results of ongoing adjuvant trials are needed to provide confirmatory evidence for or against the concept and feasibility of withdrawal therapy in locally advanced and metastatic ... post-menopausal advanced breast cancer patients heavily pre-treated with endocrine agents World J Surg Oncol 2006, 4:44 Masamura S, Santner SJ, Heitjan DF, Santen RJ: Estrogen deprivation causes estradiol...

Ngày tải lên: 09/08/2014, 02:21

4 254 0
Báo cáo khoa học: "Job stress and job satisfaction of physicians, radiographers, nurses and physicists working in radiotherapy: a multicenter analysis by the DEGRO Quality of Life Work Group" ppt

Báo cáo khoa học: "Job stress and job satisfaction of physicians, radiographers, nurses and physicists working in radiotherapy: a multicenter analysis by the DEGRO Quality of Life Work Group" ppt

... an increased individual workload for the hospital staff Breaking bad news is one of a radiotherapists most difficult duties, yet medical education typically offers little formal preparation for ... dimensional scale with nine categorical answers (1: very high job satisfaction to 9: total job dissatisfaction) Data analysis The data analysis was carried out with the programme SPSS™ 14 for Windows ... systems are undergoing major structural and financial changes Ongoing changes to cancer care include an increase in the complexity of cases, available treatment options and better informed patients...

Ngày tải lên: 09/08/2014, 09:22

9 536 1
báo cáo khoa học: "Safety in home care: A research protocol for studying medication management" pdf

báo cáo khoa học: "Safety in home care: A research protocol for studying medication management" pdf

... improper cleaning products, and moisture Stress and fatigue, in addition to a lack of preparation and education to manage an array of medications, can also degrade performance over time A caregiver's ... essential elements of an optimal medication-use system Ottawa, ON: Canadian Pharmacists Association; 2007 Lang A, Edwards N: Sadety in home care: Broadening the patient safety agenda to include home ... photo walkabout narratives, and kitchen-table talks Participant recruitment The research assistant (RA) will work with the case managers from the participating organizations (i.e., Alberta Health...

Ngày tải lên: 10/08/2014, 10:23

9 306 0
báo cáo khoa học: " Drug Checking: A prevention measure for a heterogeneous group with high consumption frequency and polydrug use - evaluation of zurich’s drug checking services" potx

báo cáo khoa học: " Drug Checking: A prevention measure for a heterogeneous group with high consumption frequency and polydrug use - evaluation of zurich’s drug checking services" potx

... amphetamines (74.8%) at least once in their life As shown in Figure 1, the initiation age for legal substances (alcohol and tobacco) was approximately 15 and the age for cannabis was approximately 16 Most ... a typical party night with at least one being an illegal substance, such as cocaine, ecstasy, amphetamines or opiates The collected data were analyzed using SPSS statistical software for Windows, ... Checking at parties Furthermore, the available results show that this target group can be reached with an acceptance-based approach and that Drug Checking should be embedded in a comprehensive and...

Ngày tải lên: 11/08/2014, 18:20

6 267 0
Báo cáo y học: "Intensive intervention for children and adolescents with autism in a community setting in Italy: a single-group longitudinal study" ppsx

Báo cáo y học: "Intensive intervention for children and adolescents with autism in a community setting in Italy: a single-group longitudinal study" ppsx

... Orbetello Satisfaction Scale for child and adolescent mental health services (OSS-cam) has been used, a tool validated for the Italian population [29] and considered as the gold standard for measuring ... of what is happening with each skill and each maladaptive behaviour targeted for treatment The data are reviewed regularly by the behaviour analyst, directing the programming so that learning ... relate to the child, in a pleasant relational manner that facilitates work on “joint attention” and, more importantly, the ability to use symbols for communication All participants regularly attend...

Ngày tải lên: 13/08/2014, 18:21

9 323 0
wi-fi toys - 15 cool wireless projects for home, office, and entertainment (2004)

wi-fi toys - 15 cool wireless projects for home, office, and entertainment (2004)

... being a peaceful baby whose only gripe was “feed me!” And thanks to my family, Nana and Papa, Aunties Lori, Alysia, Diana and Jennifer, Granddude, and the Grandmas Great and Small for letting us ... Antenna Coaxial Antenna Vertical Driven Array Antenna Directional Antennas Yagi Antenna Parabolic Antenna Panel Antenna ... USA, Europe, Japan 2.417 USA, Europe, Japan 2.422 USA, Europe, Japan 2.427 USA, Europe, Japan 2.432 USA, Europe, Japan 2.437 USA, Europe, Japan 2.442 USA, Europe, Japan 2.447 USA, Europe, Japan...

Ngày tải lên: 26/10/2014, 21:49

409 682 0
w