fluorescent protein speci fi c nanotraps to study protein protein interactions and histone tail peptide binding
Báo cáo khoa học: A DmpA-homologous protein from Pseudomonas sp. is a dipeptidase specific for b-alanyl dipeptides Hidenobu Komeda and Yasuhisa Asano docx
Ngày tải lên :
07/03/2014, 21:20
... primer, 5¢-CACTTGAAGCTTTAAGGAGGA AtagACCATGCGTATCCGTGAGCTTGGCATCACC-3¢; antisense primer, 5¢-ACGCAATCTAGAGTCAGCCCTCA GGGGGCTTTCG-3¢ The amplified PCR product was digested with HindIII and XbaI (Takara ... NiCl2, CuSO4, CuCl2, RbCl, Na2MoO4 (NH4)6Mo7O24, SnCl2, CsCl, BaCl2 and PbCl2 did not affect the activity Substrate speci city To study the substrate speci city, the purified BapA was used to hydrolyze ... aspartic protease inhibitor, pepstatin, did not influence the activity Inorganic compounds such as LiCl, H2BO3, NaCl, MgSO4, MgCl2, AlCl3, KCl, CaCl2, CrCl3, MnSO4, MnCl2, FeSO4, FeCl3, CoCl2, NiCl2,...
- 10
- 406
- 0
Báo cáo khoa học: Specific TSC22 domain transcripts are hypertonically induced and alternatively spliced to protect mouse kidney cells during osmotic stress pptx
Ngày tải lên :
30/03/2014, 10:20
... GAATCC Exon A ctttgctag ⁄ AATTTT Exon 2B tttttccag ⁄ TGCATC Exon tttttccag ⁄ TGCATC Exon tttttccag ⁄ TGCATC Exon tcttcacag ⁄ GATCTG Exon we exposed mIMCD3 cells to either of ... product was confirmed by double-pass sequencing pcDNA5 ⁄ FRT ⁄ Tsc22D2i3 construct was created by cloning the PCR product in the vector pcDNA5 ⁄ FRT ⁄ V5-His ⁄ Topo vector (Invitrogen) The construct ... mIMCD3 cells TSC22D2-4 ORF was amplified with the primers: GAAATGTTGTCCACAAGAGTGTC (forward; initiation codon in bold-type) and TGCTGAGGAGACATTCGG CTG (reverse) and the correct sequence of the PCR...
- 16
- 292
- 0
Development of a novel toll like receptor based two hybrid assay for detecting protein protein interactions and its application in the study of CD14 dimerization and FcyRIIA activation
Ngày tải lên :
12/09/2015, 08:20
... The CD14 gene and its expression 31 1.4.2 Structure 32 1.4.3 CD14 functions 35 1.4.4 LPS binding to CD14 36 1.4.5 CD14 and its receptor complex 38 1.4.6 CD14 and its signaling cascade 39 1.5 Fc ... C 105 3.5 Detection of homotypic interactions between IL-4Rα and C receptors 108 3.6 Detection of interactions between secreted proteins 115 3.7 Conclusion 116 VII Chapter Investigation of CD14 ... Introduction 1.1 Protein- protein interactions form the basis of diverse biological processes 1.1.1 Overview and historical aspects 1.2 Introduction to Toll-like receptors (TLRs) 1.2.1 Discovery...
- 236
- 494
- 0
Báo cáo khoa học: Protein–protein interactions and selection: yeast-based approaches that exploit guanine nucleotide-binding protein signaling doc
Ngày tải lên :
06/03/2014, 11:20
... associated factor 2)–Smurf2 (SMAD -speci c E3 ubiquitin protein ligase 2) EF3 (elongation factor 3)–Cch1 (high-affinity calcium channel) Ras recruitment system c- Jun c- Fos p110–p85 JDP2 C ⁄ EBPc (CCAAT ... acetyltransferase binding to ORC-1)–PR (progesterone receptor) CMV 1a (cucumber mosaic virus 1a)–TIP1 or CMV 1a–TIP2 (tonoplast intrinsic proteins) TRAF2 (tumor necrosis factor receptor associated ... which is classified as a GPCR, and the tridecapeptide a-factor functions as a pheromone and binds to the Ste2p receptor on the cell surface [32] The heterotrimeric G-proteins are closely associated...
- 14
- 443
- 0
Báo cáo khoa học: Protein–protein interactions and selection: generation of molecule-binding proteins on the basis of tertiary structural information potx
Ngày tải lên :
06/03/2014, 11:20
... 1) Accurate structural descriptions of protein protein interaction provide support for strategies to replace binding site sequences between proteins and library construction in speci c areas to ... interleukin-6, CD40L, and CD28 Conclusions and outlook Accurate structural descriptions of protein protein complexes provide support for the replacement of binding site sequences and thus binding function ... Detailed tertiary structural analyses of protein protein complexes further accurately describe epitope locations, enabling the design of and screening for bispeci c high-affinity proteins recognizing...
- 9
- 505
- 0
Guidelines for using human event-related potentials to study cognition: Recording standards and publication criteria potx
Ngày tải lên :
23/03/2014, 13:20
... or psychology without specifying what is to be clarified and why such clarification is important Because ERP studies relate to both physiology and psychology, terms and concepts specific to one ... (vii) Clinical Subjects Should Be Selected According to Clear Diagnostic Criteria and the Clinical Samples Should Be Made as Homogeneous as Possible The selection criteria for clinical subjects ... both to hold the electrode in place and to connect it electrically to the scalp, or with collodion ~either directly or in gauze! Collodion can be removed with acetone or ~preferably! ethyl alcohol...
- 26
- 492
- 0
Báo cáo khoa học: Active-site-specific chaperone therapy for Fabry disease Yin and Yang of enzyme inhibitors pptx
Ngày tải lên :
30/03/2014, 03:20
... processing and trafficking of mutant enzymes to lysosomes In addition to Fabry disease, small molecules capable of speci cally rescuing misfolded enzyme proteins have been identified for Gaucher ... identified as pharmacological chaperones for rescue of conformational defective receptors, and are reviewed elsewhere [25,26] In this review, ASSC will be used to refer to these molecules because ... in classic patients (E59K, A156V, L166V, and R356W), and two mutations present in both variant and classic patients (A97V and R301Q) were efficiently purified from transfected COS-7 cells, and...
- 10
- 548
- 0
báo cáo khoa học: "Brachypodium distachyon: a new pathosystem to study Fusarium head blight and other Fusarium diseases of wheat" pdf
Ngày tải lên :
11/08/2014, 11:20
... types of resistance have also been proposed; resistance to kernel infection (type III), tolerance against FHB and trichothecenes (type IV) [13] and tolerance to trichothecene accumulation (type ... neighbouring corrugated circular cell (arrow head) accumulating phenolic compounds (o) in response to hyphal contact (p), Upper arrow points at globose structure located above the corrugated circular cell ... fluorescence Arrows show GFP1-Fc fluorescent hyphae forming globose structures at the bmh Scale bar = 50 μm j) Confocal laser scanning microscope (CLSM) image of GFP1-Fc infection on intact Bd21...
- 14
- 342
- 0
To study clinical, subclinical features and causal viruses of Hand Foot and Mouth disease in Vietnam
Ngày tải lên :
01/11/2016, 20:29
... Subclinical tests 1.3.3.1 Biochemical and hematological exams WBC nornal or lightly increased CRP normal or lightly increased VS often increased CSF disorder when CNS complication occurs (pleocytes ... - Technics PCR (Polymerase chain reaction), RT-PCR (Reverse Transcription Polymerase Chain Reaction) are commonly applied as high sensitivity and specificity - Sequencing technic: permit to define ... Subgroup A includes 24 subgenotypes caussing diseases for human, among that CA16 is one critical cause of HFMD Other subgenotypes can cause HFMD including CA5, CA6, CA7, CA9 and CA10 Coxsackievirus...
- 12
- 474
- 0
Báo cáo khoa học: Sensitivity to Hsp90-targeting drugs can arise with mutation to the Hsp90 chaperone, cochaperones and plasma membrane ATP binding cassette transporters of yeast docx
Ngày tải lên :
07/03/2014, 21:20
... the cochaperones that are nonessential for viability of yeast (Sti1p, Sba1p, Cpr6p, Cpr7p, Hch1p and Aha1p) Sse1p and essential cochaperones such as Cdc37p and Cns1p were not included in this screen ... for Hsc70, Ydj1 and Sti(Hop) to be displaced from the complex and for other cochaperone proteins, including Sba1(p23), to bind so as to produce the later multiprotein complexes of the Hsp90 chaperone ... tumours [45] Discussion This study is the first to reveal that an increased sensitivity to Hsp90 drugs can arise with mutations to Hsp90 itself (Fig 1) and with speci c ABC transporter defects (Fig 4B)...
- 7
- 397
- 2
Báo cáo khoa học: Nucleosome positioning in relation to nucleosome spacing and DNA sequence-specific binding of a protein doc
Ngày tải lên :
16/03/2014, 10:20
... operators used in this study constitute the high-affinity, wild-type O1 operator sequence of the Escherichia coli lac operon An unidentified conformational change was reported to accompany the binding ... these modifying activities are covalent modifications of the charged histone tails, DNA methylation, incorporation of histone variants, and DNA -binding basic proteins Thus, the ionic strength of ... Wild-type operator binding and altered cooperativity for inducer binding of lac repressor dimer mutant R3 J Biol Chem 269, 12482–12487 35 Lewis M, Chang G, Horton NC, Kercher MA, Pace HC, Schumacher MA,...
- 15
- 299
- 0
Báo cáo khoa hoc:" Fusion of green fluorescent protein to the C-terminus of granulysin alters its intracellular localization in comparison to the native molecule" pptx
Ngày tải lên :
11/08/2014, 08:20
... two color immunofluorescent confocal microscopy using a polyclonal antisera reactive to granulysin and a monoclonal antibody reactive to perforin, a well characterized constituent of cytolytic ... elucidating the underlying molecular mechanisms Thus, GFP was fused to granulysin, a small secreted protein that sorts to and accumulates in cytolytic granules [5,6], and expressed in the functional ... antisera specific for GFP followed by peroxidase-conjugated antirabbit antibodies Reactive protein bands were revealed by chemiluminescent detection Russell JH, Ley TJ: Lymphocyte-mediated Cytotoxicity...
- 3
- 269
- 0
Tài liệu Báo cáo khoa học: Bacitracin is not a specific inhibitor of protein disulfide isomerase pptx
Ngày tải lên :
16/02/2014, 14:20
... evidence for the in vivo speci city of bacitracin (or potential products) for PDI inhibition Our results clearly show that bacitracin in vitro is not a speci c inhibitor of PDI, but that it interacts ... bacitracin as a speci c inhibitor for studying the role and function of PDI in cellular systems requires urgent re-evaluation Experimental procedures Bacitracin The bacitracin used in this study ... presence of mm bacitracin, the catalyzed formation of a disulfide bond in the decapeptide PDI substrate can still be observed through a decrease in its fluorescence, and this could be fitted to a first-order...
- 9
- 620
- 0
Tài liệu Báo cáo khoa học: Cobalamin uptake and reactivation occurs through specific protein interactions in the methionine synthase–methionine synthase reductase complex docx
Ngày tải lên :
18/02/2014, 08:20
... introduced into the glove box, and FeCN was added to the concentrated protein stock to fully oxidize the flavin cofactors To remove excess FeCN and O2, MSR and the isolated FMN domain were gel filtered ... reducing hMS and returning it to the catalytic cycle The turnover of hMS increases as MSR is reduced to the one-electron, two-electron and fourelectron reduced states, reflecting a higher concentration ... to refine the chaperone-like role of MSR We show that speci c protein protein interactions between hMS and MSR (over and above the need to catalyse the reductive chemistry) are required to promote...
- 10
- 698
- 0
Tài liệu Báo cáo khoa học: Specific membrane binding of the carboxypeptidase Y inhibitor IC, a phosphatidylethanolamine-binding protein family member doc
Ngày tải lên :
19/02/2014, 05:20
... that the binding interface for CPY in the IC molecule is involved in its speci c binding to anionic phospholipid membranes To further quantitatively evaluate the affinity and speci city of IC for ... proximal speci c interactions, respectively [34,35] Those findings therefore suggest that nonspeci c electrostatic interactions between the negatively charged head groups of the phospholipids, which ... 7.2), containing 0.15 m NaCl, to final concentrations of 0.5 mgÆmL)1, and were then vortexed for and sonicated for 10 min, to prepare the PC-based liposomes [42,43] IC and IC–CPY (2 lm final concentrations)...
- 10
- 645
- 1
Tài liệu Báo cáo khoa học: Specific interaction between the classical swine fever virus NS5B protein and the viral genome pdf
Ngày tải lên :
19/02/2014, 16:20
... +RNA2 +RNA3 +RNA4 +RNA5 ACCTCGTATAC –RNA0 ACCTCGTATA –RNA1 ACCTC –RNA2 ACC –RNA3 AC –RNA4 –RNA5 B 600 CGGCCC CGGCC CGGC CGG C +RNA1 B +RNA2 +RNA3 +RNA4 +RNA5 – 1 C –RNA1 –RNA2 10 11 12 13 14 15 ... that a speci c element recognized by the viral RNA polymerase to initiate RNA replication might be harbored within the plusstrand 3¢ UTR and the minus-strand 3¢ UTR To detect the speci c NS5B -binding ... transcription The plusstrand genome was first addressed: +RNA1 to +RNA5 represent, respectively, the RNA templates containing the 3¢ UTR with deletion of C , ÔCCÕ, ÔCCCÕ, ÔCCCGGÕ and the 21 nucleotide fragment...
- 9
- 560
- 0
Báo cáo khoa học: Calcite-specific coupling protein in barnacle underwater cement docx
Ngày tải lên :
07/03/2014, 05:20
... AT)-3Â and 5Â-(GCA TCA TGA TCA CGG AAA GA)-3Â for the rst PCR amplication; and 5Â-(TGA TGG CAA TGT GAT GTT GA)-3Â and 5Â-(TGC TAC CAC TGC CAC ACC GA)-3Â for the second PCR amplication The coding ... recovered by centrifugation, and the protein concentration was measured using a bicinchoninic acid protein assay kit (Pierce) with an enhanced protocol according to the manufacturers specications ... the N-terminal and C- terminal regions of mature Mrcp-20k to create the NcoI and BamHI restriction sites, respectively: 5Â-AGTTGCCATGGCGCACGAGGAGGA-3Â and 5Â-TT CTGTTCGGATCCCAAGGCTTA-3Â The amplied...
- 11
- 471
- 0
Báo cáo khoa học: Gene expression silencing with ‘specific’ small interfering RNA goes beyond specificity – a study of key parameters to take into account in the onset of small interfering RNA off-target effects potx
Ngày tải lên :
07/03/2014, 05:20
... 5¢-GGCCCAG GTGACTCAGCTATT-3¢; reverse, 5¢-AGGGCATCCGA GAATTCCTT-3¢), LAMP2 (forward, 5¢-TCAGCATTGC AAATAACAATCTCA-3¢; reverse, 5¢-CAGTCTGCTCT TTGTTGCACATATAA-3¢), CTGF (forward, 5¢-CA AGCTGCCCGGGAAAT-3¢; ... 5¢-GGACCAGGCA GTTGGCTCTA-3¢), JUN (forward, 5¢-GGATCAAGGC GGAGAGGAA-3¢; reverse, 5¢-TCCAGCCGGGCGATT-3¢), PLAU (forward, 5¢-CTGTGACCAGCACTGTCT CAGTTT-3¢; reverse, 5¢-CCCAGTGAGGATTGGATGA ACTA-3¢), ... 5¢UGACUUCCCUGGCCUAUUUUU-3¢, 5¢-ACAUUGAGC UCCUCUCUUGUU-3¢, 5¢-GAUAAGGUUGCUUCAGU UAUU-3¢ and 5¢-ACAGUACGCUAUGAAACUAUU-3¢, respectively As a negative control, we used an NT siRNA (5¢-UAGCGACUAAACACAUCAA-3¢) or a RISC-free...
- 16
- 494
- 0
Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf
Ngày tải lên :
07/03/2014, 10:20
... (5¢-ACGCGTCGACGTCGGA AATGGAGGAGTGACGG-3¢), Hi_pDEDR (5¢-CG GGATCCCGTTAATAAAAGCCTGTTGCTGGTT-3¢), Hi_Nterm F (5¢-ACGCGTCGACGTCATGACTGCTGCT CTGGCCGT-3¢), and Hi_Nterm R (5¢-CGGGATCCCGC TGCTGGTATCGCTCCTTTG-3¢), ... humidified conditions (P8), and AAAGACATA (P9), and their complementary sequences CATGTCTCT (P 2C) , CATGTCCTT (P 3C) , CATGTATTT (P 4C) , CATGGCTTT (P 5C) , CATCTCTTT (P 6C) , CAGGTCTTT (P 7C) , CGTGTCTTT (P 8C) , ... (forward, 5¢-CCTGATGCAGGCTA CAGTTCT-3¢; and reverse, 5¢-GCATATGCATGTATT TATTTTTCTTC-3¢) and standard procedures The speci c mutation (G to T) was confirmed by sequencing HeLa cells were transfected with...
- 14
- 393
- 0
Báo cáo Y học: Human immunoglobulin A (IgA)-specific ligands from combinatorial engineering of protein A ppt
Ngày tải lên :
08/03/2014, 23:20
... detection and recovery of native or recombinant IgA from different sources The selection procedure, biosensor binding affinity and speci city data of candidate ligands as well as the affinity chromatographic ... thio-b-D-galactoside to a final concentration of mM and cultivated at room temperature overnight The periplasmic fraction was collected by an osmotic shock procedure and the clones were purified by affinity ... separately injected and the responses recorded The reference surface (ABD) was used to produce subtractive sensorgrams IgA -speci c affibody ligands (Eur J Biochem 269) 2649 Construction and production of...
- 9
- 579
- 0