... C4 Photosynthesis IV The Temperature Response of C4 Photosynthesis: Biochemical Controls V Fluorescence at Low Temperature VI Stomatal Limitations VII Thermal Acclimation of C4 hotosynthesis ... Phosphoenolpyruvate carboxykinase; PPDK – Pyruvate phosphate dikinase; PPDK RP – Pyruvate phosphate dikinase regulatory protein; Rubisco – Ribulose 1,5-bisphosphate carboxylase oxygenase; WUE – Water use ... Post-translational Regulation of C4 Pyruvate Orthophosphate Dikinase Chris J Chastain Summary I Introduction II Post-translational Regulation of C4 PPDK III Functional and Bioinformatic Analysis...
Ngày tải lên: 15/04/2015, 17:20
... places that form the categories themselves, rather than the categories as such, we find that 28 different places were mentioned as the most attractive places, while there were 45 most unattractive ... representativeness of each of the categories established in the list of TABLE Frequency of most attractive and most unattractive places associated with each established category Most attractive ... Characterization of most attractive and most unattractive places on the Perceived Restorativeness Scale ‘‘Most attractive’’ place ‘‘Most unattractive’’ place Subscales (PRS) M SD M SD Being away Fascination...
Ngày tải lên: 19/02/2014, 17:20
Báo cáo toán học: "Parking functions, empirical processes, and the width of rooted labeled trees" pps
... empirical processes of mathematical statistics [26], which, we believe, has interest in itself For instance, this connection gives an alternative O(n) algorithm, for the generation of a random rooted ... Proposition 2.2 4.4 Generation of a random labeled tree An easy extension of Proposition 4.6 says that (dV +1 , dV +2 , , dV +n , dV ) satisfies constraints (2.1), and that one can generate a random labeled ... initially (0) Then, at each of the n following stages of the BFS, the vertex x at the head of the queue is removed from the queue, and all “new” neighbors of x are added at the end of the queue,...
Ngày tải lên: 07/08/2014, 06:22
UNDERSTANDING SOCIAL INTEGRATION PROCESSES IN THE USE OF ENTERPRISE SYSTEMS (ES) a SOCIAL CAPITAL PERSPECTIVE
... knowledge and information among ES users 2.5.2 Relational Dimension Secondly, relational dimension refers to assets that are created and leveraged through relationships that include attributes such ... picture of the entire implementation process that allows evaluator to better evaluate the ES implementation from ideas to impacts and finally impacts on the organizational performance (Markus and ... suggested that the benefits of ES are dependent on the nature of the organization and most benefits derived from ES application vary from organization to organization Many issues that occurred...
Ngày tải lên: 14/09/2015, 09:01
An investigation into the use of gaussian processes for the analysis of microarray data
... the redundant features In addition to the irrelevant features created above, we created two additional features that are exact duplicate of the original two features These two features are therefore ... treatment in four datasets, namely Breast cancer dataset, Colon cancer dataset, Leukaemia dataset and Ovarian cancer dataset It will be expensive to directly apply Gaussian Processes on the datasets ... set of features and add in feature or a set of features with certain criteria), backward elimination (a search begins with the full set of features) or best first search (a search that allows backtracking...
Ngày tải lên: 28/09/2015, 13:38
Catalytic fast pyrolysis of biomass the reactions of water and
... the bed both at room temperature (~1 torr) and at operational temperature (~ torr) During an experiment, samples containing 50 mg of biomass were introduced at a rate of approximately one every ... pyrolysis are passed over catalysts at elevated temperatures to reject oxygen from the pyrolysis products in the form of water, CO, and CO2.7 HZSM-5 has been widely studied as a catalyst for the CFP ... through formation of light gases and excessive coking of the catalyst Catalyst coking also results in fouling and rapid deactivation, which means that the catalyst will require frequent regeneration...
Ngày tải lên: 09/10/2015, 14:39
Strategies for selection of thermochemical processes for the valorisation of biomass
... extent or rate of a chemical reaction on time and temperature Study of kinetics involves using mathematical models that quantify the relationship between the rate of reaction, time, and temperature ... that have been tested are the effect of variations in final temperature, gas used, pressure, heating rate, and particle size Various reactor configurations have been used, which give us information ... environment, reactor used, pyrolysis temperature, rate of heating and source of heat Longer vapour residence time favours the production of bio-char Moderate temperatures and short vapour residence...
Ngày tải lên: 27/07/2016, 15:56
7 the dictionary of transport and logistics 7214
... operations to refer to the temperature below that of normal air at which point mechanical (or other) means of cooling/chilling is necessary for satisfactory carriage of food, etc Ambient temperature ... legislation which detail new law or give relevant government Secretaries of State powers to create subordinate legislation in the form of regulations published in Statutory Instruments or Statutory ... a tachograph installation that ensures the drive cable from the vehicle gearbox rotates at correct speed to provide accurate indication and recording of speed and distance at the tachograph instrument...
Ngày tải lên: 30/08/2013, 23:58
A CFD analysis of transport phenomena and electrochemical reactions in a tubular-shaped PEM fuel cell
... The temperature peak appears in the cathode catalyst layer, implying that major heat generation takes place in the region In general, the temperature at the cathode side is higher than that at ... that the mass balance equations for both ( ) ( ) phases are; ∇ ⋅ ((1 − sat )ρ g εu g ) = m phase ∇ ⋅ (sat.ρ l εu l ) = m phase where sat is saturation, ε is porosity (8) (9) The momentum equation ... functional variation of capillary pressure with saturation is prescribed following Leverett [10] who has shown that; ⎛ ε ⎞ Pc = τ ⎜ ⎟ ⎝ KP ⎠ 12 (1.417(1 − sat ) − 2.12(1 − sat ) + 1.263(1 − sat ) ) (12)...
Ngày tải lên: 05/09/2013, 14:58
TEACHING PRONUNCIATION TO THE FIRST YEAR STUDENTS AT THE UNIVERSITY OF TRANSPORT AND COMMUNICATIONS a CASE STUDY
... on pronunciation They concluded that pronunciation practice in class had little affect on the learner's pronunciation skills and, moreover ‘that the attainment of accurate pronunciation in a ... show that ‘a threshold level of pronunciation in English such that if a given non-native speaker’s pronunciation falls below this level, he or she will not be able to communicate orally no matter ... Without adequate pronunciation skills the learner’s ability to communicate is severely limited Morley believes that not attending to a student’s pronunciation needs, ‘is an abrogation of professional...
Ngày tải lên: 07/09/2013, 13:45
Tài liệu Improving health, connecting people: the role of ICTs in the health sector of developing countries ppt
... Communication Communication for Social Change Civil Society Organisation Department for International Development UN Food and Agricultural Organisation Faith Based Organisations Family Health International ... of data types For example, the automation of patient records must deal with a variety of data requirements and specification problems found in many health care data types which are exacerbated ... for the development and operation of information systems and enable the creation and application of knowledge Information systems function at many levels of sophistication and complexity — from...
Ngày tải lên: 14/02/2014, 09:20
Tài liệu Bond Market Structure in the Presence of Marked Point Processes doc
... Proof The main part of the statement follows immediately from Proposition 5.5 The last statement follows from the fact that, if we fix the maturities at t = such that the corresponding det B(t) ... determination of a point estimate of λQ , but the problem here is that we are not making observations under Q, but under P Thus the estimation of the Q-intensity λQ is not a statistical estimation ... that the operators Kt (ω) are integral operators of the first kind We shall refer to K as “the martingale operators” Corollary 4.3 Suppose that the forward rate dynamics is given by (3), that...
Ngày tải lên: 16/02/2014, 02:20
Tài liệu Research " THE IMPACT OF LOGISTICS STRATEGY AND LOGISTICS INFORMATION TECHNOLOGY PROCESSES ON SERVICE PERFORMANCE " docx
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khóa học: Quantitative analysis, using MALDI-TOF mass spectrometry, of the N-terminal hydrolysis and cyclization reactions of the activation 2 process of onconase pdf
... Finally, data obtained at 70 °C showed that the formation of pyroglutamyl was completed in h at pH 8.0, with no degradation of the protein At pH 2.5, although cyclization was faster at 70 °C when ... observed that temperature accelerates the reaction rate However, because the substrate is a polypeptide, care was required with the pH of the reaction Combining high or low pH with high temperature ... glutathione (GSH) to a final concentration of 0.1 M, the pH was adjusted to 8.5 with solid Tris, and the samples were incubated at room temperature for h under a nitrogen atmosphere Insoluble material...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo khoa học: Key role of the loop connecting the two beta strands of mussel defensin in its antimicrobial activity docx
... measurement at 600 nm after 24 h incubation at 30 °C The minimal inhibitory concentration (MIC) was evaluated by testing serial doubling dilutions and defined as the lowest peptide concentration that prevented ... laser-scanning observations M lysodeikticus (105 CFU in midlogarithmic phase) were immobilized on a glass slide by a 10 centrifugation at 2500 g at room temperature, and incubated for h at 37 °C with ... FITC-streptavidin At concentrations of 1–60 lM, both biotinylated peptide D (Fig 3A) and biotinylated peptide B (not illustrated) decorated the cell surface but apparently did not penetrate the bacteria...
Ngày tải lên: 20/02/2014, 11:20
Báo cáo khoa học: Amino acid limitation regulates the expression of genes involved in several specific biological processes through GCN2-dependent and GCN2-independent pathways ppt
... aminoacylation for protein translation Mitochondrion organization and biogenesis Negative regulation of protein kinase avtivity Positive regulation of developmental process Main pathways of carbohydrate ... together, these results demonstrate that rapamycin and amino acid deprivation not regulate the same pattern of genes, suggesting that the mTORC1 and GCN2 pathways not regulate the same physiological ... signaling pathway responsible for this regulation involves the kinase GCN2, which is activated by free tRNA accumulation during amino acid starvation [7,18] Once activated, GCN2 phosphorylates the...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: Protein transport in organelles: The Toc complex way of preprotein import pdf
... of Toc34 (atToc33 and atToc34) [15,16], and four paralogs each of Toc159 (atToc159, atToc132, atToc120 and atToc90) [17–20] and Toc75 (atToc75-III, atToc75-IV, atToc75-I and atToc75V ⁄ atOep80) ... atToc159 (159) and atToc33 (33) and the translocation channel atToc75-III (75) Note that the homologues of atToc159 (atToc90, atToc120, atToc132) and atToc33 (atToc34) may assemble with atToc75 into ... specificity overlap between atToc159 ⁄ atToc33 and atToc132 ⁄ atToc120 ⁄ atToc34 So far, no information is available on Toc core complexes containing atToc90 (At5 g20300), the only atToc159 isoform lacking...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: Protein transport in organelles: The composition, function and regulation of the Tic complex in chloroplast protein import pptx
... Tic40 AtTic110 (At1 g06950) AtTic62 (At3 g18890) AtTic55 (At2 g24820) AtTic40 (At5 g16620) Tic32 AtTic32-IVa (At4 g23430) AtTic32-IVb (At4 g23420) AtTic32-IVc (At4 g11410) AtTic22-IV (At4 g33350) AtTic22-III ... (At4 g33350) AtTic22-III (At3 g23710) AtTic21/AtPIC1 (At2 g15290) AtTic20-I (At1 g04940) AtTic20-IV (At4 g03320) AtTic20-V (At5 g55710) AtTic20-II (At2 g47840) AtHsp93-V (At5 g50920) AtHsp93-III (At3 g48870) Tic22 ... hydrophobic patch on the surface of the protein, whereas the C-terminus features a series of Pro/ Ser-rich repeats (blue) that allow specific binding of FNR Tic22 is a soluble protein located in the...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: Use of lithium and SB-415286 to explore the role of glycogen synthase kinase-3 in the regulation of glucose transport and glycogen synthase pdf
... mediated by a mechanism that is distinct from that used to stimulate GS The observation that SB-203580 suppresses Li-stimulated glucose uptake implies that Li stimulates the p38 MAP kinase pathway ... that an analysis of the GS activity ratio in 3T3-L1 preadipocytes reveals that in unstimulated cells, basal GS activity was 80% lower than that measured in differentiated adipocytes This lower ... loading control, lysates were immunoblotted with an antibody to native PKBa The blots are representative from up to three separate experiments Alternatively cells following insulin treatment were assayed...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: Re-evaluation of the function of the F420dehydrogenase in electron transport ofMethanosarcina mazei potx
... molecular hydrogen To evaluate the reason for the different growth rates and methane-formation rates with trimethylamine as a substrate, cell lysates and washed membrane preparations of the wild-type ... Finally, we showed that the puried FpoF functions as an Fd:F420 oxidoreductase The results of the immunoblotting experiments indicated that FpoF is present at relatively high concentrations in the cytoplasm ... Germany) The fpoF ă PCR fragment was generated with the primers 5Â-ATGG TACGTCTCAAATGCCACCAAAGATTGCAGAAGTCA TT-3Â and 5Â-ATGGTACGTCTCAGCGCTGACTGTT TCACTGCGGATTCCG-3Â It was digested with BsmBI and...
Ngày tải lên: 14/03/2014, 23:20