flowing text through a document

Báo cáo khoa học: "A Semi-Supervised Key Phrase Extraction Approach: Learning from Title Phrases through a Document Semantic Network" docx

Báo cáo khoa học: "A Semi-Supervised Key Phrase Extraction Approach: Learning from Title Phrases through a Document Semantic Network" docx

... the abbreviation and synonymy phenomena, we construct a thesaurus and convert all manual and automatic phrases into their canonical forms when evaluated The traditional Recall, Precision and ... phrases Afterwards, our approach is evaluated against two existing approaches, which rely on the conventional semantic network and are able to capture binary relations only One approach combines ... Wikipedia and AI workshop at the AAAI-08 Conference, Chicago, US Dengyong Zhou, Jiayuan Huang and Bernhard Schölkopf 2005 Beyond Pairwise Classification and Clustering Using Hypergraphs MPI Technical...

Ngày tải lên: 23/03/2014, 16:20

5 367 0
Some aspects of American culture and society in the twentieth and twenty-first centuries through a number of selected short literary works

Some aspects of American culture and society in the twentieth and twenty-first centuries through a number of selected short literary works

... picture of an American woman in the late 1920s Doreen Sulivan, a beautiful woman from Philadelphia, had an appearance which was a fashion of the day with a thin, sleeveless dress over a light camisole, ... United States Barack Obama who has made a history in American presidency to be the first black to hold the office African American have gained recognizable stand in American society that they ... leading in their big mansions… Smoking jackets and cravats, spats and canes, elegant garden parties and martinis… This was a world of so elegantly distant from ours, it was like a voyage to another...

Ngày tải lên: 07/11/2012, 15:01

49 785 1
Hydromagnetic convective flow past a vertical porous plate through a porous medium with suction and heat source

Hydromagnetic convective flow past a vertical porous plate through a porous medium with suction and heat source

... friction at the wall against Kp for different values of magnetic parameter M and heat source parameter S are entered in Tables and respectively From Table 1, we observe that a growing magnetic parameter ... m7 = A6 = − A5 + A4 + A3 , A7 = A1 0 = A7 − A8 + A9 , B1 = A1 m5 (m3 − m5 )(m4 + m5 ) , A8 = A1 m1 (m3 − m1 )(m4 + m1 ) , A9 = A2 m7 (m3 − m7 )(m4 + m7 ) , 2 A1 A3 Pr G r A1 A5 Pr G r − A1 A4 Pr ... field are magnetic parameter M, permeability parameter Kp, Grashof number for heat transfer Gr and heat source parameter S The effects of these parameters on the velocity field have been analyzed...

Ngày tải lên: 05/09/2013, 16:10

12 428 0
Tài liệu Báo cáo khoa học: C-Terminal extension of a plant cysteine protease modulates proteolytic activity through a partial inhibitory mechanism doc

Tài liệu Báo cáo khoa học: C-Terminal extension of a plant cysteine protease modulates proteolytic activity through a partial inhibitory mechanism doc

... N-Pro 208 aa 34 aa CT - ex Stop 114 aa Xho1 365 aa 24 aa 208 aa N-Pro N Pro II 24 aa Protease domain BamH H1 Start I 114 aa Pre A S Dutta et al Protease domain CT - ex 34 aa III 208 aa N-Pro NP ... latex of Ervatamia coronaria Biosci Biotechnol Biochem 62, 1947–1955 15 GuhaThakurta P, Biswas S, Chakrabarti C, Sundd M, Jagannadham MV & Dattagupta JK (2004) Structural basis of the unusual ... (isolated from the latex of Ervatamia coronaria in our laboratory) and papain from Carica papaya (Merck, Kenilworth, NJ, USA)], two serine proteases [trypsin and chymotrypsin from bovine pancreas...

Ngày tải lên: 14/02/2014, 14:20

13 760 0
Tài liệu Báo cáo khoa học: Activated Rac1, but not the tumorigenic variant Rac1b, is ubiquitinated on Lys 147 through a JNK-regulated process docx

Tài liệu Báo cáo khoa học: Activated Rac1, but not the tumorigenic variant Rac1b, is ubiquitinated on Lys 147 through a JNK-regulated process docx

... ubiquitination is unlikely to be related to a defective membrane interaction While being persistently activated and associated with plasma membrane, Rac1b has an impaired ability to activate several ... that the stimulation of Rac1-dependent pathways may, in some way, activate the Rac1 ubiquitination machinery As Rac1b has been shown to display reduced capacity to bind POSH [28] and to activate ... ligase Itch Science 306, 271–275 40 Tapon N, Nagata K, Lamarche N & Hall A (1998) A new rac target POSH is an SH3-containing scaffold protein involved in the JNK and NF-kappaB signalling pathways...

Ngày tải lên: 18/02/2014, 16:20

11 470 0
Tài liệu Báo cáo Y học: Ornithine decarboxylase-antizyme is rapidly degraded through a mechanism that requires functional ubiquitin-dependent proteolytic activity pot

Tài liệu Báo cáo Y học: Ornithine decarboxylase-antizyme is rapidly degraded through a mechanism that requires functional ubiquitin-dependent proteolytic activity pot

... 689–697 26 Matsufuji, S., Miyazaki, Y., Kanamoto, R., Kameji, T., Murakami, Y., Baby, T.G., Fujita, K., Ohno, T & Hayashi, S (1990) Analyses of ornithine decarboxylase antizyme mRNA with a cDNA cloned ... cDNA encoding mammalian ornithine decarboxylase Proc Natl Acad Sci USA 81, 3645–3649 30 Graham, F.L & van der Eb, A. J (1973) A new technique for the assay of infectivity of human adenovirus DNA ... antizyme is a rapidly degraded protein and that as with ODC, the degradation of antizyme is also carried out by the proteasome Antizyme mRNA contains two variably used in-frame initiation codons...

Ngày tải lên: 22/02/2014, 04:20

7 382 0
Tài liệu Playing through: A Guide to the Unwritten Rules of Golf potx

Tài liệu Playing through: A Guide to the Unwritten Rules of Golf potx

... replaced, and littering xi playing through golf cart abuse Walking car ts and riding car ts are great conveniences and can save your back, but they also can wreak havoc on other people’s golf games ... appreciate the beauty of the places that, as golfers, we get to enjoy I was having a particularly bad day on a course in Pagosa Springs, Colorado After yet another lousy shot, my cart mate came over, ... putting and hand them to us This made the round easy and very pleasant I have an electric handcart One day I hadn’t charged the battery fully and it ran out of juice As I was pushing it back to...

Ngày tải lên: 22/02/2014, 08:20

223 405 0
Báo cáo khoa học: The SWI⁄SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING finger protein Unkempt doc

Báo cáo khoa học: The SWI⁄SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING finger protein Unkempt doc

... process takes place Indeed, although Rac activation is believed to occur primarily at the plasma membrane, BAF60b ubiquitination is controlled by Rac and Unkempt BAF60b, as well as BAF6 0a and BAF60c, ... cellular mRNA levels were monitored by RT-PCR (Access RT-PCR system; Promega, Madison, WI, USA) using Unkempt-specific primers 5¢TCTTCGAGTG CAAGTCCAAA and 5¢AAGATCACCTGTGCCTCCAC, and normalized against ... Tsuchiya A, Kiyono M, Nosaka T et al (2006) Rac1 and a GTPaseactivating protein, MgcRacGAP, are required for nuclear translocation of STAT transcription factors J Cell Biol 175, 937–946 26 Michaelson...

Ngày tải lên: 06/03/2014, 09:22

12 432 0
Báo cáo khoa học: Organizing signal transduction through A-kinase anchoring proteins (AKAPs) docx

Báo cáo khoa học: Organizing signal transduction through A-kinase anchoring proteins (AKAPs) docx

... proteasomal degradation or stabilization of the transcription factor HIF- 1a AKAP signaling AKAP-Lbc signaling complex AKAP-Lbc is another multivalent anchoring protein that organizes PKA and PKC ... proteins (AKAP150, mAKAP and AKAP-Lbc) and their interacting partners are discussed in detail (Table 1) AKAP79/150 signaling complexes To date, AKAP150 (the murine homolog of human AKAP79) remains ... classic enzyme feedback loop because anchored PKA activity eventually leads to the termination of cAMP signals Interestingly, the same AKAP A B C D Fig mAKAP signaling complexes (A) mAKAP assembles...

Ngày tải lên: 06/03/2014, 22:21

6 357 0
Báo cáo khoa học: The transcription factor ZBP-89 suppresses p16 expression through a histone modification mechanism to affect cell senescence doc

Báo cáo khoa học: The transcription factor ZBP-89 suppresses p16 expression through a histone modification mechanism to affect cell senescence doc

... 5¢-AGACAGCCGTTTTACACGCAG-3¢; P2 antisense, 5¢-CACCGAGAAATCGAAATCACC-3¢; P3 sense, 5¢-TAGGAAGGTTGTATCGCGGAGG-3¢; and P3 antisense, 5¢-CAAGGAAGGAGGACTGGGCTC-3¢ [28] The locations of P1, P2 and P3 at the p16 ... isothiocyanate-conjugated goat anti-(rabbit serum) as secondary antibody, incubated with rat anti-3MeK9H3 serum and stained with TRITCconjugated goat anti-(rat serum) as secondary antibody, and finally ... data The target RNAi sequence for ZBP-89 was 5¢-GAGCAGAAGCAGGTG CAGA-3¢ [29] The p16-targeting siRNA sequence was 5¢-GAGGAGGTGCGGGCGCTGC-3¢ [18] An oligonucleotide that represents the small hairpin...

Ngày tải lên: 07/03/2014, 02:20

10 374 0
Reducing Childhood Obesity in Ontario through a Health Equity Lens docx

Reducing Childhood Obesity in Ontario through a Health Equity Lens docx

... food, clean air, affordable child care, accessible and affordable recreation services, and access to high quality health care 23 Bierman et al, ‘Social Determinants of Health and Populations at Risk’, ... health is far higher for marginalized populations Health inequities – differences in health outcomes that are avoidable, unfair, and systematically related to social inequality and disadvantage ... Determinants of Health and Populations at Risk’, p 29 29 Bierman et al, ‘Social Determinants of Health and Populations at Risk’, p 29 30 Raine, Overweight and Obese in Canada: A Population Health...

Ngày tải lên: 08/03/2014, 15:20

13 322 0
Báo cáo khoa học: Mammalian 105 kDa heat shock family proteins suppress hydrogen peroxide-induced apoptosis through a p38 MAPK-dependent mitochondrial pathway in HeLa cells potx

Báo cáo khoa học: Mammalian 105 kDa heat shock family proteins suppress hydrogen peroxide-induced apoptosis through a p38 MAPK-dependent mitochondrial pathway in HeLa cells potx

... Biotechnology, Santa Cruz, CA, USA); cleaved caspase-3, rabbit polyclonal anti-cleaved caspase-3 (Asp175) (#9661; Cell Signaling Technology, Danvers, MA, USA); caspase-9, rabbit polyclonal anti-caspase-9 ... Yasuda K, Nakai A, Hatayama T & Nagata K (1995) Cloning and expression of murine high molecular mass heat shock proteins, HSP105 J Biol Chem 270, 29718– 29723 Ishihara K, Yasuda K & Hatayama ... of caspase-3 mediated by heat shock In mammalian cells, one of the main pathways that activates procaspase-3 is via mitochondria When the mitochondria receive appropriate signals from a variety...

Ngày tải lên: 16/03/2014, 06:20

13 216 0
Báo cáo khoa học: Efficient synthesis of a disulfide-containing protein through a batch cell-free system from wheat germ pdf

Báo cáo khoa học: Efficient synthesis of a disulfide-containing protein through a batch cell-free system from wheat germ pdf

... [9] at the linker region was constructed by amplifying the whole plasmid pEU-scFvLH by inverse PCR with the primers s2: 5¢-CAAAAAATTGAATGGCATG AACCGCCGAGCTCCAAC-3¢ and a2 : 5¢-AGCTTCAA AAATATCATTTAAACCCGACGGGCTGCTTTT-3¢ ... prepared from wheat embryos: plants apparently contain a suicide system directed at ribosomes Proc Natl Acad Sci USA 97, 559–564 Sawasaki, T., Hasegawa, Y., Tsuchimochi, M., Kamura, N., Ogasawara, ... Kawasaki et al (Eur J Biochem 270) Antigen-binding analyses We then examined the antigen binding activity The soluble material from each reaction was loaded on an antigen column and was separated...

Ngày tải lên: 16/03/2014, 23:20

7 331 0
Báo cáo khoa học: "Unsupervised Decomposition of a Document into Authorial Components" pdf

Báo cáo khoa học: "Unsupervised Decomposition of a Document into Authorial Components" pdf

... be made clear below 4.1 (Almost) Automatic Synset Identification One of the advantages of using biblical literature is the availability of a great deal of manual annotation In particular, we are ... books As a first try, the basics of which will serve as a foundation for more sophisticated attempts, we the following: Represent each chapter as a bag-of-words (using all words that appear at least ... minḥâh and nā a tend to be located in the same units and, concomitantly, miqṣ a , tĕrûmâh and šāṯal are located in the same units Conveniently, the former are all Jeremiah and the latter are all...

Ngày tải lên: 17/03/2014, 00:20

9 359 0
synthesis and growth of hematite nanodiscs through a facile hydrothermal approach

synthesis and growth of hematite nanodiscs through a facile hydrothermal approach

... Electronica S.L., Spain); The Brunauer–Emmett–Teller (BET) surface area of the as-prepared particles was measured at 77 K (liquid nitrogen) on a Quantachrome Autosorb-6B Surface Area & Pore Size Analyzer ... 10b The measured curves for calculating BET surface area of particles were plotted and analyzed It can be seen that the surface area of aFe2O3 nanodiscs (triangle spotted lines) was estimated to ... probably caused by the fast hydrolysis rate at a high pH (*3.0) The diffraction rings in the SAED patterns (inset of Fig 6, panels a c) revealed that the as-prepared nanoparticles are of crystalline...

Ngày tải lên: 20/03/2014, 13:08

17 623 0
Báo cáo khoa học: Folding of epidermal growth factor-like repeats from human tenascin studied through a sequence frame-shift approach pdf

Báo cáo khoa học: Folding of epidermal growth factor-like repeats from human tenascin studied through a sequence frame-shift approach pdf

... apparatus using a PrePak Cartridge 25 · 100 mm (Agilent) casted on a PrepLC Universal Base apparatus (Waters) and a Zorbax 300SB-C18 9.4 · 250 mm (Agilent) Samples were eluted using a linear gradient ... Fmoc-protected amino acids were purchased from ChemImpex International (Wood Dale, IL, USA), Fluka (Buchs, Switzerland), Advanced Biotech Italia (Seveso, Italy) and NovaBiochem (Darmstadt, Germany) TentaGel ... of experimental data with a three-parameter negative exponential curve (R > 0.99, data not shown) gave an apparent rate constant value of 0.54 min)1 for EGF-14, and values in the range 0.22–0.26...

Ngày tải lên: 23/03/2014, 13:20

12 416 0
Báo cáo khoa học: "A Latent Topic Extracting Method based on Events in a Document and its Application" pot

Báo cáo khoa học: "A Latent Topic Extracting Method based on Events in a Document and its Application" pot

... Analysis Recent Advances in Natural Language Processing:144–149 Manabu Okumura and Eiji Nanba 2005 Science of knowledge: Automatic Text Summarization.(in Japanese) ohmsha Manabu Okumura and Hajime ... summarization Journal of Artificial Intelligence Research (JAIR Harendra Bhandari, Masashi Shimbo, Takahiko Ito, and Yuji Matsumoto 2008 Generic Text Summarization Using Probabilistic Latent Semantic ... the data sets for evaluating the result of summarization, as a query, and then use it as a query for query-biased summarization As an evaluation method, we adopt precision and coverage used at...

Ngày tải lên: 23/03/2014, 16:20

6 397 0
Báo cáo khoa học: "Refining Event Extraction through Cross-document Inference" pot

Báo cáo khoa học: "Refining Event Extraction through Cross-document Inference" pot

... ACE 2005 System Description Proc ACE 2005 Evaluation Workshop Washington, US Hilda Hardy, Vika Kanchakouskaya and Tomek Strzalkowski 2006 Automatic Event Classification Using Surface Text Features ... References David Ahn 2006 The stages of event extraction Proc COLING/ACL 2006 Workshop on Annotating and Reasoning about Time and Events Sydney, Australia Ralph Grishman, David Westbrook and Adam Meyers ... Annotator1 Human Annotator2 Inter-Annotator Agreement Trigger Identification +Classification P R F Argument Identification P R Argument Classification Accuracy F Argument Identification +Classification...

Ngày tải lên: 23/03/2014, 17:20

9 208 0
Báo cáo khoa học: "BULK PROCESSING OF TEXT ON A MASSIVELY PARALLEL COMPUTER" docx

Báo cáo khoa học: "BULK PROCESSING OF TEXT ON A MASSIVELY PARALLEL COMPUTER" docx

... O¢~inaI-Address: N Parallel Sorting A parallel sort is similar in function to a serial sort It accepts as arguments a parallel data field and a parallel comparison predicate, and it sorts among ... Dictionary Algorithm • F(r (a, b), c) • F(F(F (a, b), c), d) There is a faster and more elegant approach to building a dictionary than the hashing scheme This other approach has the additional advantage ... parallel natural language programs on real hardware has clarified which operations and programming techniques are the most efficient and useful Programs that build upon general algorithms such as...

Ngày tải lên: 24/03/2014, 02:20

8 306 0
Báo cáo Y học: CTGF/Hcs24 induces chondrocyte differentiation through a p38 mitogen-activated protein kinase (p38MAPK), and proliferation through a p44/42 MAPK/extracellular-signal regulated kinase (ERK) doc

Báo cáo Y học: CTGF/Hcs24 induces chondrocyte differentiation through a p38 mitogen-activated protein kinase (p38MAPK), and proliferation through a p44/42 MAPK/extracellular-signal regulated kinase (ERK) doc

... mitogen-activated protein kinase pathway Proc Natl Acad Sci USA 97, 1113–1118 Yonekura, A. , Osaki, M., Hirota, Y., Tsukazaki, T., Miyazaki, Y., Matsumoto, T., Ohtsuru, A. , Namba, H., Shindo, H & Yamashita, ... otherwise specified, all experiments were repeated at least twice, with similar results One-way analysis of variance (ANOVA ) was used for statistical evaluation Statistical analysis was performed by ... Miyazaki, Y., Osaki, M., Shindo, H & Yamashita, S (2000) Activation of specific MEKERK cascade is necessary for TGF beta signaling and crosstalk with PKA and PKC pathways in cultured rat articular...

Ngày tải lên: 24/03/2014, 04:21

8 377 0
w