fixed place of business paragraphs 1 and 2
Tài liệu Báo cáo khoa học: Functional hierarchy of plasminogen kringles 1 and 4 in fibrinolysis and plasmin-induced cell detachment and apoptosis docx
... respectively, cells and fibrin: A10 .2 ¼ 9 .2 nM and nM; 34D3 ¼ 13 .1 nM and nM; mAb mix ¼ 11 .8 nM and nM K4-LBS is permanently exposed, supports this hypothesis Blockage by mAb A10 .2 of K4-LBS exposed ... fibrin and fibrinogen J Biol Chem 25 8, 424 9– 425 6 22 Knudsen BS, Silverstein RL, Leung LL, Harpel PC & Nachman RL (19 86) Binding of plasminogen to extracellular matrix J Biol Chem 2 61, 10 765 10 7 71 23 ... Chem 25 7, 21 0 4– 21 1 0 41 Markus G, DePasquale JL & Wissler FC (19 78) Quantitative determination of the binding of epsilon-aminocaproic acid to native plasminogen J Biol Chem 25 3, 727 –7 32 42 Markus...
- 14
- 558
- 0
Tài liệu Báo cáo Y học: Binding of gelsolin domain 2 to actin An actin interface distinct from that of gelsolin domain 1 and from ADF/cofilin pptx
... and mixed with 11 2 12 5 and 11 9– 13 2 actin peptides As shown in Fig 8B, the 11 9 13 2 peptide does not perturb FITC In contrast the 11 2 12 5 peptide induces a fluorescence decrease of the label, but ... sequences Peptide 15 9 19 3 Kd ELISA Peptide 15 9 19 3 Kd fluorescence Cofilin Kd Reference for cofilin Actin G Actin F 1 10 18 28 84 10 3 11 2 12 5 11 9 13 2 347–365 338–348 360–3 72 355–375 1. 3 mM ND No binding ... Two peptides belonging both to the 11 4 22 5 sequence and exposed regions of subdomain were tested (11 2 – 12 5 and 11 9 – 13 2 peptides) Interaction of the 15 9 19 3 fragment with the coated peptides...
- 11
- 460
- 0
Brilliant At The Basics of Business 100:1 pdf
... for example? Or points of margin? Or employee satisfaction? Nicholasbate.typepad.com © Nicholas Bate 2 010 Brilliant At The Basics of Business 10 0: 74 Get out of the office and find out what’s going ... costs are ‘About’ businesses go bust About when their money runs out Nicholasbate.typepad.com © Nicholas Bate 2 010 Brilliant At The Basics of Business 10 0: 19 Train your people Soft skills: how ... allowing you to focus on the timeless skills of leadership and selling? Nicholasbate.typepad.com © Nicholas Bate 2 010 Brilliant At The Basics of Business 10 0: 39 Get Skillful Sportspeople, plumbers,...
- 10
- 501
- 0
Báo cáo Y học: Structural and serological relatedness of the O-antigens of Proteus penneri 1 and 4 from a novel Proteus serogroup O72 pptx
... penneri strain 40 41 25 600 < 10 0 < 10 0 320 0 320 0 25 600 < 10 0 < 10 0 320 0 320 0 12 800 < 10 0 < 10 0 < 10 0 < 10 0 12 800 < 10 0 < 10 0 < 10 0 < 10 0 6400 < 10 0 < 10 0 5 12 00 6400 < 10 0 < 10 0 NT NT < 10 0 NT NT O-antiserum ... b-D-GalpNAcII- (1 ® a-D-GlcpII- (1 ® C1 C2 C3 C4 C5 C6 10 5.6 10 2. 6 99.7 74.3 52. 5 68.8 76.9 81. 6 81. 3 70.4 69 .2 77 .1 75.4 75.7 71. 5 66.8 61. 9 62. 2 10 5 .1 54 .1 72. 5 69 .1 76 .2 62. 5 10 5.6 10 2. 6 99.8 74.3 52. 4 ... 25 600 25 600 12 800 12 800 31. 7 15 .8 25 0.0 25 0.0 0.5 0.5 7.8 7.8 25 6000 10 24 000 10 00 10 00 6400 5 12 00 10 0 10 0 12 5.0 7.9 > 10 00 > 10 00 > 10 00 > 10 00 Table Passive immunohemolysis of the alkali-treated...
- 6
- 560
- 0
Báo cáo khoa học: Inhibitors of protein phosphatase 1 and 2A decrease the level of tubulin carboxypeptidase activity associated with microtubules pptx
... Sugimura, T (19 90) 24 25 26 27 28 29 30 Calyculin A, an inhibitor of protein phosphatases, a potent tumor promoter on CD -1 mouse skin Cancer Res 50, 35 21 3 525 Li, Y.-M & Casida, J.E (19 92) Cantharidin-binding ... inhibitors of PP1 and PP2A [23 ,24 ], showed effects similar to that of OA (Fig 4) Deltamethrin, a specific inhibitor of PP2B [25 ], and phenylarsine oxide, a putative inhibitor of tyrosine phosphatases [26 ], ... IMAGING SYSTEM and, for each condition, the ratio Glu/Tyr was calculated A/B ¼ 0 .17 ± 0.03; C/D ¼ 1. 21 ± 0 .15 ; E/F ¼ 0 .28 ± 0.04; G/H ¼ 1. 12 ± 0 .17 Each value represents the mean ± SE of four independent...
- 9
- 301
- 0
báo cáo hóa học:" Gene and microRNA analysis of neutrophils from patients with polycythemia vera and essential thrombocytosis: down-regulation of micro RNA-1 and -133a" pot
... 27 .8 1, 1 81 ± 10 91 8,4 21 ± 2, 684 930, 916 ± 650,0 21 527 ,593 ± 45 ,14 17 338 ± 330 10 9.0 ± 52. 9 1, 9 62 ± 1, 665 39.4 ± 32 .1 0. 0 12 3 0. 014 5 0. 018 5 0. 019 0 0. 022 0 0. 020 9 0. 024 9 0. 026 3 0.03 52 0.03 81 0.04 21 ... hsa-miR -19 a hsa-miR -20 0b hsa-miR-5 42- 3p hsa-mir- 625 hsa-miR -10 6b hsa-miR -20 b 4 .11 2. 63 2. 47 2. 43 2. 21 1.93 1. 92 1. 86 1. 86 1. 81 1.76 1. 73 1. 70 1. 66 1. 63 1. 6 1. 48 1. 43 1. 42 1. 33 1. 31 hsa-miR -13 3a hsa-miR-504 ... P 1, 707, 21 1 ± 5,080 716 ± 19 5 62. 6 ± 9.9 54 .1 ± 63 .1 5, 21 5 ± 1, 606 28 7,485 ± 89,954 13 1,558 ± 35 ,29 8 21 . 0 ± 13 .0 61. 1 ± 7.5 473 .1 ± 23 9 11 .1 ± 6.5 10 ,467, 524 ± 7,793,493 1, 6 72 ± 854 93.5 ± 27 .8...
- 17
- 524
- 0
Financial Audit of the Department of Business, Economic Development and Tourism_part1 docx
... July 1, 19 98 and was abolished by the Legislature on July 1, 20 02 This is trial version www.adultpdf.com Chapter 1: Introduction Exhibit 1. 1 Organizational Structure of the Department of Business, ... Assets, June 30, 20 02 42 Statement of Activities, Year Ended June 30, 20 02 43 Balance Sheet - Governmental Funds, June 30, 20 02 44 Statement of Revenues, Expenditures, and Changes in ... postaudits of the transactions, accounts, programs, and performance of all departments, offices, and agencies of the State of Hawaii (State) and its political subdivisions Background Section 26 -18 ,...
- 10
- 392
- 0
Financial Audit of the Department of Business, Economic Development and Tourism_part2 potx
... loans written off as of June 30 FY2000- 01 FY1999 -20 00 94 96 10 6 45 49 53 48% 51% 50% $9,449,566 $9,9 71, 27 7 $ 12 ,10 7 ,29 2 $5,568,059 $5,9 31, 910 $6, 611 ,25 2 59% 59% 55% $2 81, 418 $734,966 $6, 824 To assist ... totaled $22 6 ,17 1, and the average number of business days elapsed between their receipt and deposit was six business days Checks amounting to $83, 325 and $29 ,500 were deposited six and nine business ... Scope and Methodology We audited the financial records and transactions and reviewed the related systems of accounting and internal controls of the department for the fiscal year July 1, 20 01 to...
- 10
- 361
- 0
FINANCIAL AUDIT OF THE DEPARTMENT OF BUSINESS, ECONOMIC DEVELOPMENT AND TOURISM STATE OF HAWAII Fiscal Year Ended June 30, 2009 _part1 docx
... 46,996 50 ,19 5 97 ,19 1 $ 1, 615 14 ,580 16 ,19 5 $ $ 50 ,19 5 30,8 01 80,996 Total liabilities and net assets $ 97 ,19 1 53,330 53 ,26 8 10 6,598 1, 653 13 ,770 15 , 423 53 ,26 8 37,907 91, 175 $ 10 6,598 Analysis of Net ... IIl1 ~ AMERICAN SAVINGS BANK TOWER 10 01 BISHOP STREET, SUITE 17 00 HONOLULU, HAWAII 96 813 -3696 N&K (PAs, Inc ACCOUNTANTS I CONSULTANTS T (808) 524 ~22 55 F (808) 523 -20 90 March 19 ,2 010 Ms Marion ... TOWER 10 01 8ISHOPSTREET, SUITE 17 00 HONOLULU, HAWAII 96 813 -3696 N&K (PAs, Inc T (808) 524 22 55 F (808) 523 -20 90 ACCOUNTAN[SICONSULT~ INDEPENDENT AUDITORS' REPORT To the Auditor Office of the...
- 12
- 281
- 0
FINANCIAL AUDIT OF THE DEPARTMENT OF BUSINESS, ECONOMIC DEVELOPMENT AND TOURISM STATE OF HAWAII Fiscal Year Ended June 30, 2009 _part2 pdf
... 5,7 61, 0 72 2 ,24 8, 020 9, 022 , 9 12 1, 3 41, 28 7 1, 3 82, 3 12 1, 0 91, 9 82 290,330 1, 828 , 21 2 4 91, 668 1, 724 , 729 509,7 31 1,464,950 398,8 91 25 9,779 11 0,840 1, 575,737 2, 010 ,3 41 2, 0 71, 915 2, 876,357 2, 417 , 717 2, 239,3 62 ... 966,543 1, 725 ,949 21 0 ,946 1, 909, 814 6 91, 768 2, 028 , 416 12 ,9 72, 728 14 ,957,884 8, 827 ,740 6 ,13 0 ,14 4 1, 29 3 ,17 0 1, 23 3,670 1, 011 , 517 22 2 ,15 3 10 ,9 91, 697 l'V w 11 ,6 21 , 434 9,794 ,22 5 1, 827 ,20 9 52, 515 ,460 83 ,15 6, 719 ... statements (1, 317 , 515 ) (1, 474,396) (1, 926 ,876) (2, 757,8 71) (4,8 71, 9 31) (2 ,18 9 ,17 8) (1, 924 ,4 21 ) (23 3,4 51) (6,6 01, 24 3) (2 ,16 9,773) (490,430) (1, 777, 5 12 ) (5 81, 185) (28 , 315 ,7 82) $ (10 ,17 8,944) 91. 174, 726 ...
- 12
- 282
- 0
FINANCIAL AUDIT OF THE DEPARTMENT OF BUSINESS, ECONOMIC DEVELOPMENT AND TOURISM STATE OF HAWAII Fiscal Year Ended June 30, 2009 _part3 ppt
... 85,970 ,14 5 (3 ,16 3,5 71 ) (26 ,2 81, 547) (5,480,060) (959 ,16 2) (2, 014 ,000) (1, 405,870) 43 ,16 0 (4 , 12 2, 733) (28 ,29 5,547) (6,8 42, 770) Total accumulated depreciatiol (34, 925 ,17 8) (4,379,0 32) 43 ,16 0 (39 ,2 61, 050) ... Development Special Revenue 2, 087,396 $ (13 , 613 ,26 7) 17 , 814 ,994* $ (9,498,053) (16 7,4 61) (10 9,746) (11 ,11 2, 388)* 2, 797,663* (27 ,064)* (1, 27 6,864) $ (7.687.864) $ (5. 416 , 926 ) * Amounts reflect the ... 3 31, 047 (496,559) 2, 950,000 536,466 3,6 51, 978 3 31, 047 (496,559) 3,486,466 14 ,6 82, 807 59,0 21 , 786 10 ,836,076 15 ,469 937 ,24 4 5 21 , 330 (44,567) 14 ,698 ,27 6 59,959,030 11 , 3 12 ,839 84,540,669 1, 474,043 (44,567)...
- 12
- 255
- 0
Department of Business, Economic Development and Tourism State of Hawaii NOTES TO THE BASIC FINANCIAL STATEMENTS June 30, 2009_part4 ppt
... Administration Awards 11 . 419 11 . 419 11 . 419 11 . 419 NA05NOS 419 1 060 NA06NOS 419 015 9 NA07NOS 419 015 9 NA08NOS 419 04 21 22 9,576 2 51, 670 683 ,26 0 493,486 1, 657,9 92 Habitat Conservation 11 .463 NA04NMF4630366 28 Manufacturing ... Training, and Technical Analysis/Assistance $ 19 9,0 02 81. 117 81. 117 81. 117 81. 117 10 ,27 8 366 44,507 9,500 64,6 51 81. 119 81. 119 81. 119 State Energy Program Special Projects DE-FG26-08NT04686 DE-FG26-07NT4 329 8 ... DE-FG26-07NT4 329 8 DE-FG36-06R0386 02 DE-FG36-04R0 21 5 98 DE-FG26-03R0 21 4 96 DE-FG26-05R0 21 6 57 DE-FG26-05R0 21 6 68 25 , 825 62 ,16 1 3 ,22 3 91, 20 9 354,8 62 Total U.S Department of Energy $ TOTAL EXPENDITURES OF FEDERAL...
- 12
- 321
- 0
Department of Business, Economic Development and Tourism State of Hawaii NOTES TO THE BASIC FINANCIAL STATEMENTS June 30, 2009_part5 ppt
... Comptroller General of the United States; and OMB Circular A -13 3, Audits of States, Local Governments, and NonProfit Organizations Those standards and OMB Circular A -13 3 require that we plan and perform ... CIRCULAR A -13 3 To the Auditor Office of the Auditor State of Hawaii: Compliance We have audited the compliance of the Department of Business, Economic Development and Tourism State of Hawaii (DBEDT) ... March 15 , 2 010 This is trial version www.adultpdf.com 52 PART IV SCHEDULE OF FINDINGS AND QUESTIONED COSTS This is trial version www.adultpdf.com 53 Department of Business, Economic Development and...
- 8
- 279
- 0
Báo cáo hóa học: " Research Article Fixed Points of Weakly Contractive Maps and Boundedness of Orbits" doc
... Analysis and Applications, vol 27 3, no 1, pp 11 2 12 0, 20 02 [11 ] D W Boyd and J S W Wong, “On nonlinear contractions,” Proceedings of the American Mathematical Society, vol 20 , no 2, pp 458–464, 19 69 ... 459–465, 19 62 [15 ] G Jungck, Fixed point theorems for semi-groups of self maps of semi-metric spaces,” International Journal of Mathematics and Mathematical Sciences, vol 21 , no 1, pp 12 5 13 2, 19 98 ... 2b + 4c + 5e + 3g ≤ In Theorem 2. 2, set s = b + e + g, μ ≡ − (a + 2c + g), γ00 ≡ a, γ 01 = 10 ≡ c, γ 21 ≡ g, and γi j ≡ 0, otherwise Then (C) implies (2. 2) In Theorem 2. 3, set s = b + e + g, and...
- 12
- 180
- 0
Báo cáo toán học: "Graphs Associated with Codes of Covering Radius 1 and Minimum Distance 2" ppsx
... electronic journal of combinatorics 15 (20 08), #R68 3 X X X 0 Figure 5: The partial Latin square equivalent {000, 011 , 022 , 10 1, 11 0, 13 3, 20 2, 21 3 , 2 21 , 23 0, 303, 320 , 3 32} to the code Figure ... permutation R ( 12 ) C ( 12 ) S ( 12 ) squares with row of 032X and 023 X are equivalent to squares with row of 013 X and 031X Thus only squares with row of 0 12 X, 021 X, 013 X, or 031X are considered (figure 16 ) • ... 1, 2) = 16 We completely catalogue (3, V, 2) 4 codes where V = 8, 9, 10 , 11 , 13 , 14 , 15 , 16 and provide some examples for V = 12 Theorem 12 [6, Thm 3 .14 ] There is a unique (3, 8, 2) 4 code Proof...
- 17
- 252
- 0
báo cáo khoa học: " FCR (Fludarabine, Cyclophosphamide, Rituximab) regimen followed by 90yttrium ibritumomab tiuxetan consolidation for the treatment of relapsed grades 1 and 2 follicular lymphoma: a report of 9 cases" pot
... et al Journal of Experimental & Clinical Cancer Research 2 011 , 30 :16 http://www.jeccr.com/content/30 /1/ 16 Received: 30 September 2 010 Accepted: February 2 011 Published: February 2 011 References ... (Table 2) Restage before RIT: CT, PET, BMB Zevalin® FCR -28 CYCLES 11 .1- 14.8 MBq/Kg CR/CRu or PR F: 25 mg/m2 i.v days 1- 3 C: 1gr/m2 i.v day R: 375mg/m2 i.v day Figure Treatment schema Restage 12 weeks ... cycles of FCR: fludarabine at a dose of 25 mg/m2 i.v on days to 3; cyclophosphamide at a dose of gr/m2 i.v on day and rituximab Page of at a dose of 375 mg/m2 was given on day of each cycle every 28 ...
- 5
- 287
- 0
Báo cáo y học: " Molecular characterization of genome segments 1 and 3 encoding two capsid proteins of Antheraea mylitta cytoplasmic polyhedrosis virus" pps
... http://www.virologyj.com/content/7 /1/ 1 81 Page of 11 Analysis of recombinant AmCPV S1 and S3 encoded proteins expressed in E coli and insect cells AmCPV S1 and S3 were expressed in E coli M15 cells as insoluble 14 1 kDa (Fig 2A, ... pH-7.3 (B), and at pH - 12 (C) and analyzed by TEM at 50 kV Bar 10 0 nm Chakrabarti et al Virology Journal 2 010 , 7 :18 1 http://www.virologyj.com/content/7 /1/ 1 81 Page of 11 Table Stability of native ... Chakrabarti et al Virology Journal 2 010 , 7 :18 1 http://www.virologyj.com/content/7 /1/ 1 81 Page of 11 Figure Immunoblot analysis of recombinant VLPs using anti-p137 and anti-p1 41 antibodies (A) SDS-8% PAGE,...
- 11
- 307
- 0
Báo cáo y học: "Transcriptional regulation of matrix metalloproteinase-1 and collagen 1A2 explains the anti-fibrotic effect exerted by proteasome inhibition in human dermal fibroblasts" docx
... 4, 12 11 Geneva 14 , Switzerland and 2Department of Pathology and Immunology, Geneva University Hospital and School of Medicine, rue Michel Servet 1, 12 11 Geneva 14 , Switzerland 19 Received: 10 ... transfection and reporter gene assays COL1A1 Hs0 016 4099_m1 TIMP -1 Hs0 017 1558_m1 MMP -1 Hs0 023 3958_m1 MMP -2 Hs0 023 4 422 _m1 HsEEF1A1 CACCTGAGCAGTGAAGCCAGCTGCTT DNA pull-down assay Biotin-MMP -1- S GATCGAGAGGATGTTATAAAGCATG ... 19 Received: 10 December 20 09 Revised: April 2 010 Accepted: 29 April 2 010 Published: 29 April 2 010 21 20 ArthritisGoffin et al.;Therapy 2 010 , 12 :R73 under the terms of the Creative Commons Attribution...
- 14
- 286
- 0
the blackwell dictionary of business ethics (werhane and freeman)
... blackwell-synergy.com/links/doi /10 .11 11/ 14 71 8847.00007/abs/) Paul, R J and Townsend, J B (19 97) AIDS in the workplace: Balancing employer and employee rights Review of Business, 18 (2) , 14 Sedgwick, E K (19 90) Epistemology of ... Organizations, and Society, 15 , 28 Arya, A., Glover, J C., and Sunder, S (20 03) Are unmanaged earnings always better for shareholders? Ac counting Horizons 17 (supplem.): 11 1 16 Baxter, J and Chua, W F (20 03) ... Journal of Accounting and Public Policy, 13 : 79 94 Miller, P and O’Leary, T (19 87) Accounting and the construction of the governable person Accounting, Or ganizations, and Society, 12 (3), 23 5 65...
- 601
- 566
- 0
The roles of histone deacetylases 1 and 2 in hepatocellular carcinoma
... 17 1. 9 Cooperative and distinct functions of HDAC1 and 18 1. 9 .1 Redundancy of HDAC1 and HDAC2 functions 18 1. 9 .2 Distinct functions of HDAC1 and HDAC2 19 1. 10 Inhibition of ... 20 1. 11 Biological effects and mechanisms of action of HDAC inhibitors 20 1. 11. 1 Apoptosis 20 1. 11. 2 Growth arrest 22 1. 11. 3 Mitotic disruption and autophagy ... 23 1. 11. 4 Anti-angiogenesis, anti-metastasis and invasion 24 1. 11. 5 Anti-tumor immunity 25 1. 12 HDAC inhibitors in cancer therapy 26 1. 12 .1 Clinical trials 26 ...
- 168
- 372
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25