... S RNA of TULV. GGAAAUG GCCAAGU G-C A- U G-C A- U U -A G G U -A G:U C A- U U -A 337 381 (+) sense U:G U -A C U C-G U -A C-G U -A C-G U -A A-U C C A- U C A G U -A A-U (-) sense A C A- U G A G-C A- U CCUUUAC ... (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855). To monitor the presence of recTULV S RNA, RT-PCR was performed with primers RECF738 (5'GCCAGAGAAGATTGAGGCATTTC3'; nt 738–760) and Hairpin-like ... types of S RNA using specific primer pairs at the stage of nested PCR gave exactly the same result. The V-type S RNA was detected during all ten passages while the REC-type totally disappeared after...
Ngày tải lên: 18/06/2014, 22:20
The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System
... prevent. • Data manager changes data. A malicious data manager may change the value of its data on each cache refresh. While this is an advantage for shared memory applications, it is a serious ... temporarily allow read-only access to cached data. The locking on a page may later be changed as deemed necessary by the data manager. [To avoid race conditions, the pager_data_provided call also ... to the default pager is identical to other external data managers, there are no fundamental assumptions made about the nature of secondary storage. For example, the default pager may use local...
Ngày tải lên: 12/09/2012, 15:05
List the components of a radio system
... sent – Imprints a unique address on the data – The longer the code is, the more users will be able to share the same channel – Number of chips in the code • Determines the amount of spreading or bandwidth Wireless ... (TDMA) – Divides the transmission time into several slots – Each user is assigned the entire frequency for the transmission • For a fraction of time on a fixed, rotating basis – Advantages • Uses the bandwidth ... strength falls near the level of noise – Interference can take place • To reduce the interference of noise – Boost the strength of the signal – Use of filters when receiving the signal • Attenuation – A...
Ngày tải lên: 13/09/2012, 10:52
Cambridge.University.Press.Africans.The.History.of.a.Continent.Aug.2007.pdf
... lineages of mitochondrial DNA exist among the San (‘Bushmen’) of southern Africa and the Biaka Pygmies of the modern Central African Republic. About 100,000 years ago, some of these anatomically ... common in the East African highlands by 20,000 years ago, appeared at that date also in southern Africa, spread into western and northern Africa during the next 10,000 years, and thereafter became ... that it awaits further confirmation. 8 The forest margin of Cameroun and Nigeria was the region from which Bantu speakers gradually expanded throughout the southern half of Africa. All Bantu languages...
Ngày tải lên: 21/09/2012, 10:39
Guest the meaning of a word
... guest the meaning of a word Could you guest the sign of a new word? Yes, Of couse. This is 20 prefix and 14 root-word helping you improve your vocabulary. You can guest the meaning of 14.000 ... hurl, cast)]. offer: ob-và ferre [Gồm các biến dạng fer và lat (Latin: line, bring, carry)]. insist: in-và stare [Các biến dạng c a stare là sta, stat, sti, và sist (Greek: standing, stay, make ... talk, speech, speak; word)]. aspect: ad-và specere [Gồm có 2 dạng spec và spic (Latin: see, sight, look, appear, behold, and examine)]. uncomplicated: un-, com-,và plicare [Có 11 biến dạng sau:...
Ngày tải lên: 02/10/2012, 12:07
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"
... and Methods: The data obtained from all of the four university hospitals, and one referral tertiary-care educational state hospital in Ankara. Antimicrobial resistance profiles of 14,233 selected ... Hospital setting and antibiotic policy: NARP was initiated in Turkey in February 2003 by a central regulation of Ministry of Health and was announced nation-wide via official newspaper of the ... we have esca- lated all antibiotic prices. The cost of antibiotics was calculated as US dollars (USD). Statistical Analysis: Rates in every 6 months periods of the study period were analyzed...
Ngày tải lên: 25/10/2012, 11:00
The closeness of a foreign sales contract in Binh Minh Household Joint Stock Company
... wise to adopt the internal law as governing law to the contract. On the other hand, the parties can agree to adopt a certain world law regarding international trade that can listed here as CISG (Convention ... an international transaction. Unless parties are assured that the coverage is available in the amount designated, the failure of a party to obtain insurance coverage should not be grounds for termination of ... in an amicable way. If the parties fail to read an agreement in such way, the dispute shall be brought to the Central of the International Arbitration under Chamber of Commerce and industry of...
Ngày tải lên: 18/04/2013, 08:57
Experimental study on the performance of a prism-shaped integrated collector-storage solar water heater
Ngày tải lên: 05/09/2013, 15:28
Factors influencing borrower’s behavior and decision making patterns in the success of a micro finance model
Ngày tải lên: 06/09/2013, 05:48
Tài liệu The message of a master - By John McDonald pdf
... said: the great masses of humanity are using the Law destructively, or partially so, and the scales are balanced against them. Here and there, among the masses, we find an occasional outstanding ... as the beasts of the field, the birds of the air and the fish of the sea are bountifully supplied. For any man, no matter what his station in life, to take the stand that it is the destiny of ... that I had met my deliverer, and at the close of the performance was overjoyed at his invitation to accompany him to a nearby café. I noticed that the attention of those in the café was drawn...
Ngày tải lên: 15/12/2013, 06:15
Tài liệu HOW TO MEASURE THE IMPACT OF A CRM STRATEGY ON THE FIRM PERFORMANCE doc
... sophisticated information systems and data warehouses been able to manage a great deal of data. The challenge is to capture and measure soft and qualitative information. For example, in the book The Experience ... can wonder if the popularity of non-financial measures from an academic point of view is accompanied by the same success from a managerial perspective. There are a few researchers who have analysed ... conventional methods have the advantage of being investment evaluation settings. Their major drawback of evaluation is that they focus on the estimation of cash flows and accounting criteria (Kim,...
Ngày tải lên: 20/12/2013, 17:15
Tài liệu Exporting the Results of a Query as a String docx
... that separate columns. The default value is the TAB character. rowDelimiter The character or characters that separate rows. The default value is the CARRIAGE RETURN character. nullExpr A string ... table. SqlDataAdapter da = new SqlDataAdapter("SELECT * FROM Orders", ConfigurationSettings.AppSettings["Sql_ConnectString"]); DataTable dt = new DataTable(ORDERS_TABLE); ... creating a DataTable containing the Orders table from Northwind. The GetString( ) method in this solution is called to convert the DataTable into a string similar to one that is generated by the...
Ngày tải lên: 24/12/2013, 05:15