finding the main idea in a paragraph

Ngày tải lên: 08/10/2014, 16:46

Ngày tải lên: 08/10/2014, 16:46

... idea of paragraph 3. c. It’s a supporting idea for the main idea of the whole passage. d. It’s a supporting idea for paragraph 3. 2 . In the passage, what is the sentence In fact, middle income ... idea of a paragraph is like an umbrella that “covers” the rest of the sentences in the paragraph. The other sentences in the paragraph offer support for the main idea. But what exactly is that ... carefully and answer the questions that follow. As you read, see if you can deter- mine: 1. The overall main idea 2. The main idea of each paragraph (major supporting ideas) 3. Minor supporting ideas Be...

Ngày tải lên: 25/10/2013, 17:20

... used. In either case, data is loaded into the DataSet and the collections of rows and columns in the DataSet are iterated over to display the data and to demonstrate the effect of the schema annotations. ... TableNameDataTable typedPlural DataTable methods NewTableNameRowAddTableNameRowDeleteTableNa meRow typedName DataRowCollect ion TableName typedPlural DataRow TableNameRow typedName DataColumn DataTable.ColumnNameColumnDataRow.ColumnName ... available annotations for each. Table 2-18. Default values and available annotations for elements of strongly typed DataSet objects Element Default name Annotatio n DataTable TableNameDataTable...

Ngày tải lên: 24/12/2013, 05:15

... contained within the OleDbDataAdapter control will query against to limit the data displayed in the list box. A command button will be added to allow you to call the Fill method of the OleDbDataAdapter ... parameter of the OleDBDataAdapter1, which was created by using the ? in the Select statement of 1.2 Limit the Data Displayed in a Bound List Box Even populating a list box with a couple of ... your form and start a new one as described at the beginning of the steps for this one, you have the instructions there. Otherwise, by the time you reach How-To 1.8, you will have a data entry...

Ngày tải lên: 21/01/2014, 12:20

... operation and maintain as well (Watson and Hobson, 1989, Kadlec and Knight, 1996, Mitsch and Gosselink, 2000). They form one possible promising and feasible approach for a small scale decentralized ... subsurface flow wetland is designed as a tank with an impervious boundary to prevent seepage and contain a suitable porous media in which emergent plants grow. The water remains below the surface ... emergent plants grow. The water remains below the surface of the gravel/stone/rock media. All the complicated physicochemical and biological interactions among vegetation, microorganisms, soil and...

Ngày tải lên: 24/01/2014, 00:20

... C 6)12 fatty acids We purified the recombinant O-MACS protein to exam- ine whether it has an acyl-CoA synthetase activity like other MACS family proteins. The recombinant plasmid carrying either the ... 5Â-cttcctgtgtcaagtggcag-3Â (for- ward), 5Â-gttggcagtggcattcacga-3Â (reverse); and NeuroD 5Â-aagacgcatgaaggccaatg-3Â (forward), 5Â-catgatgcgaatggct atcg-3Â (reverse). Hybridization, washing, antibody reaction and ... figures. The o-macs transcripts are detected in all cell layers; supporting cell layer (s), OSN layer (n), basal layer (b), and lamina propria (lp). The o-macs mRNA was not detected in the apical (a) ...

Ngày tải lên: 08/03/2014, 02:20

... that bank balance sheets “remain fragile and capital buffers may still be inadequate in the face of further increases in nonperforming loans.” 3 2. Interest rate risk, exchange rate risk and ... such data are not available for Saudi Arabia. b) From 1-Jan-10 to 29-Jul-10. c) Based on banks contained in respective countries' Datastream bank indices. d) Based on banks in Datastream ... the remaining weaknesses of these economies, while inflation pressures (as RISKS AHEAD FOR THE FINANCIAL INDUSTRY IN A CHANGING INTEREST RATE ENVIRONMENT 18 OECD JOURNAL: FINANCIAL MARKET...

Ngày tải lên: 15/03/2014, 01:20

... speaking in general and teaching speaking in particular. In the Chapter 2, we will investigate how speaking lessons are dealt with by teachers and students in Minh Thanh secondary school in ... mother tongue if they are grouped with those having the same language, and particularly talking in small groups because they find it easier and more natural to speak their mother tongue than ... the class into two teams and play some kind of game. You could have the left side of the room against the right side, boys against girls, or each row against all the others. Competition can...

Ngày tải lên: 15/03/2014, 10:03

... D ATTTGAACTGTGCCAGGACTGGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGAGAGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGAAGGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAAGGAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAGGGATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAGGGTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAATTGGGGATCT Mut ... MYB1 ATTTGAACTAGACCAATGCTGGGAGAAAAAATTTAAGATCT Mut A ATTTGAACTGTGAAGATGCTGGGAGAAAAAATTTAAGATCT Mut B Mut C Mut D ATTTGAACTGTGCCAGGACTGGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGAGAGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGAAGGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAAGGAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAGGGATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAGGGTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAATTGGGGATCT Mut ... 5Â-GGCGGATCCAAGCCAGTGGTTGTTAAT AC-3Â and 5Â-GCCTCGAGAATCAAGTGTCCCTGCACC T-3Â (LIN-54-DN); 5Â-GCGGATCCGAGGTGGTGCCAG CTGAG-3Â,5Â-GCTCTAGAGAATGGAAGCCGTGCCT G-3Â,5Â-GCTCTAGATTGGCAGATGCAGCTGAAGTA- 3Â and 5Â-GCCTCGAGAATCAAGTGTCCCTGCACCT-3Â (LIN-54-DCXC);...

Ngày tải lên: 23/03/2014, 04:20

... 42 What and With Whom What and With Whom Canada Trades Canada Trades  Balance of trade – the difference between the value of exports and the value of imports  Balance of trade contains ... 58 International Economic International Economic Policy Organizations Policy Organizations  Governmental international organizations that encourage international cooperation include:  The ...  There are also informal organizations such as:  The Group of Five (Japan, Germany, Britain, France, and the U.S.) which meets to promote negotiations and coordinate economic relations among nations. ...

Ngày tải lên: 29/03/2014, 17:20

... of law. In the same way, just as it is not only essential that we maintain ourselves as a liberal democratic society as an aim in itself, but, by doing so, we will ensure that we can maintain ... justice and humanity of the law . . .’ 13 33. It may be difficult to ensure that that bargain could be maintained by entirely virtual hearings. It may be hard to maintain the seriousness of litigation ... have all played an important part in our legal history. Given the entrepreneurial nature of its lawyers, they are playing an important part today, and I am sure they will continue to play an...

Ngày tải lên: 31/03/2014, 03:20

... these frac- tures, with majority of them belonging to either the intrameduallary or the sliding hip plate category. The advantages of intrameduallary fixation system are decreased intra-operative ... externally rotated right lower extremity that was painful to log-roll and axial load. Otherwise the patient was neurovascu- larly intact. The initial radiographs showed a 3- part inter-trochanteric ... Heffernan, Christina Kane, Walter Leclair Abstract Hip fractures are a common injury among the elderly. Internal fixation with an intramedullary (IM) system has gained popularity for the treatment...

Ngày tải lên: 20/06/2014, 04:20

... setting of an unstable fracture pattern, there was togg ling of the nail within the intrameduallary canal which led to the medial migration of the Lag Screw with repeated axial loading. This is the ... shortened and externally rotated right lower extremity that was painful to log-roll and axial load. Otherwise the patient was neurovascu- larly intact. The initial radiographs showed a 3- part inter-trochanteric ... sliding hip plate category. The advantages of intrameduallary fixation system are decreased intra-operative blood los s and operating room time with immediate load-bearing. Better clinical out- comes...

Ngày tải lên: 20/06/2014, 07:20

... into a capacity planning system. Any changes to the probability of the deal are automatically reflected in the capacity planning system and the closing of the deal fires off a process in the inventory ... consolidation has the potential not only to reduce the costs associated with storing and maintaining data, but also to make data more relevant. Too many organizations are saddled with an assortment ... sales process, define an ideal flow, and ensure that all criteria are met and data captured before a deal advances to the next stage. Organizations should also be able to take established sales...

Ngày tải lên: 27/06/2014, 14:20

... N decrease, led to a small increase in C:N ratio of orga- nic matter in the A 1 layer and (ii) increase in the “base” cations that could be explained by the intense mineralisation of the forest-floor. ... via throughfall was within the range of European data [30] but was rather high in comparison to a set of French data [83]. Mean annual litterfall in the mature Douglas-fir stand was estimated at ... nitrogen mineralisation rate increases after a clear-cut. Several authors have described an increase in nitrogen availa- bility after a clear-cut [8, 78, 87] and other studies describe an increase in...

Ngày tải lên: 08/08/2014, 01:21

... yet are able to assess temporal and spatialrelativevariations. The relationship between a variable measured at the sampling point and the same variable measured with a small spatial displacement, ... “openness” variables, whereas the remaining 7 variables are “foliage” variables. Shaded areas indicate the couples of variables that are issued from a common device (and should not be taken into account). * indicates ... by Schmitt and Bariteau [38]. 2.2. Plant canopy analyzer The LAI-2000 Plant Canopy Analyser (Li-Cor, Lin - coln Inc., NE, USA) was used to assess the plant area in - dex (PAI) and the diffuse non-interceptance...

Ngày tải lên: 08/08/2014, 14:21

Ngày tải lên: 08/08/2014, 23:22

Ngày tải lên: 09/08/2014, 04:21

Ngày tải lên: 10/08/2014, 10:23