finding all tables that include a specific column value

báo cáo khoa học: " Uncovering high rates of unsafe injection equipment reuse in rural Cameroon: validation of a survey instrument that probes for specific misconceptions" ppsx

báo cáo khoa học: " Uncovering high rates of unsafe injection equipment reuse in rural Cameroon: validation of a survey instrument that probes for specific misconceptions" ppsx

Ngày tải lên : 11/08/2014, 18:20
... Burkina Faso has since adopted a national injection safety policy that restricts the importation of syringes that are not reuse prevention feature syringes that engage automatically, like the auto-disable ... Kinshasa, Zaire Lack of association with occupational exposure JAMA 1986, 256:3099-3102 53 Kumwenda N, Kumwenda J, Kafulafula G, Makanani B, Taulo F, Nkhoma C, Li Q, Taha T: HIV-1 incidence among ... questionnaires, facilitating data collection and mobilizing staff to participate in study All authors read and approved the final manuscript Authors’ information MPO: This is a medical doctor in Cameroon;...
  • 9
  • 390
  • 0
Finding All the Best Swaps of a Minimum Diameter Spanning Tree Under Transient Edge Failures

Finding All the Best Swaps of a Minimum Diameter Spanning Tree Under Transient Edge Failures

Ngày tải lên : 16/06/2016, 01:35
... fail This approach entails at least two advantages: First, as a failure happens, we are prepared to switch immediately to the emergency network; second, and perhaps most important, we can evaluate ... among all possible spanning trees is named a minimum diameter spanning tree (MDST) A best swap edge for a failing edge of a MDST is a swap edge that keeps the diameter of the swap tree as low as ... [8] G Italiano and R Ramaswami Maintaining spanning trees of small diamete Algorithmica, 22(3):275–304, 1998 [9] E Nardelli, G Proietti, and P Widmayer How to swap a failing edge of a single source...
  • 19
  • 396
  • 0
Procedural Abstraction and Functions That Return a Value

Procedural Abstraction and Functions That Return a Value

Ngày tải lên : 12/09/2012, 22:48
... the formal parameter names  Formal parameters are like placeholders for the actual arguments used when the function is called  Formal parameter names can be any valid identifier Example: double ... parameter names may or may not match variable names used in the main part of the program  It does not matter if formal parameter names match other variable names in the program  Remember that only ... programming language  Top Down Design (also called stepwise refinement)  Break the algorithm into subtasks  Break each subtask into smaller subtasks  Eventually the smaller subtasks are trivial to...
  • 94
  • 541
  • 0
RELATIONSHIP BETWEEN ALLOCHTHONOUS DOC CONCENTRATION AND A SPECIFIC UV254 ABSORBANCE (SUVA) AT A MESO-STRATIFIED RESERVOIR

RELATIONSHIP BETWEEN ALLOCHTHONOUS DOC CONCENTRATION AND A SPECIFIC UV254 ABSORBANCE (SUVA) AT A MESO-STRATIFIED RESERVOIR

Ngày tải lên : 05/09/2013, 08:40
... season All data Upper layer Wet season Dry season Middle layer Wet season Dry season Bottom layer Wet season Dry season All data at Jannge site Wet season Dry season All data at Jannge site Wet season ... Reservoir area Watershed area Reservoir length Average depth Water capacity Effective capacity Yearly average inflow, outflow Hydraulic residence time Urban area in drainage basin Paddy area in drainage ... contrast, in artificial dam reservoirs such as Daecheong, normally located at the upstream part of a river in mountainous terrain, inflows usually enter at upper end of the reservoir Galapate et al...
  • 7
  • 428
  • 0
Vocabulary list 10 - Short Words That Mean a Lot

Vocabulary list 10 - Short Words That Mean a Lot

Ngày tải lên : 25/10/2013, 17:20
... sham ( sham) (noun) something false or empty that is said to be genuine; one who assumes a false character; an impostor After a year of marriage, he recognized his wife as a and sadly saw that ... extreme or unsalvageable because the narrator says that there was no way to get his money back at that point The last sentence describes the narrator’s “so-called friend” as a miserable bane of his ... that evidenced her innocence, the woman on the stand was able to herself of all criminal charges staid ( stad) ¯ (adj.) characterized by sedate dignity and propriety; sober Fixed; permanent At...
  • 14
  • 865
  • 1
Tài liệu 18 Web-Marketing Concepts That Make a Difference pptx

Tài liệu 18 Web-Marketing Concepts That Make a Difference pptx

Ngày tải lên : 20/12/2013, 17:15
... John, Paul, George, or Ringo confused with Steve Jobs Amazing! Worry just a little less about all that small-print stuff and more on building a memorable brand that people will remember, and that ... going to be customers anyway No company can be all things to all people, and companies that try never go anywhere Tell people who you are and what you do, and forget about all the other stuff; ... to have an identity, a personality, an image—and there is no better way to create that identity than with a video of a real person delivering your marketing message in an entertaining, memorable...
  • 6
  • 469
  • 0
Tài liệu Reading a Column Value Using Strongly Typed DataSet Classes pptx

Tài liệu Reading a Column Value Using Strongly Typed DataSet Classes pptx

Ngày tải lên : 21/01/2014, 07:20
... System.Data.SqlClient.SqlDataAdapter(); mySqlDataAdapter.SelectCommand = mySqlCommand; MyDataSet myDataSet = new MyDataSet(); sqlConnection1.Open(); mySqlDataAdapter.Fill(myDataSet, "Customers"); sqlConnection1.Close(); ... MyDataSet.CustomersDataTable myDataTable = myDataSet.Customers; foreach (MyDataSet.CustomersRow myDataRow in myDataTable.Rows) { listView1.Items.Add(myDataRow.CustomerID); listView1.Items.Add(myDataRow.CompanyName); ... Using a Strongly Typed DataSet Class Once you have your strongly typed MyDataSet class, you can create an object of that class using the following code: MyDataSet myDataSet = new MyDataSet();...
  • 7
  • 288
  • 0
Tài liệu Adviceguide Advice that makes a difference pptx

Tài liệu Adviceguide Advice that makes a difference pptx

Ngày tải lên : 15/02/2014, 13:20
... have the right to appeal against a decision about the amount of an overpayment You can also appeal against any penalty which HMRC have asked you to pay in connection with your tax credits claim ... you haven't met yours, you'll normally be asked to pay back all of the overpayment If you have met all of your responsibilities but HMRC haven't met theirs, you won’t be asked to pay back all ... circumstances, you may be able to make an appeal after that You should make your appeal to the Tax Credit Office (see under Further help for details) Problems with paying back your overpayment...
  • 4
  • 266
  • 0
Tài liệu Báo cáo Y học: A novel meta-cleavage dioxygenase that cleaves a carboxyl-groupsubstituted 2-aminophenol Purification and characterization of 4-amino-3-hydroxybenzoate 2,3-dioxygenase from Bordetella sp. strain 10d doc

Tài liệu Báo cáo Y học: A novel meta-cleavage dioxygenase that cleaves a carboxyl-groupsubstituted 2-aminophenol Purification and characterization of 4-amino-3-hydroxybenzoate 2,3-dioxygenase from Bordetella sp. strain 10d doc

Ngày tải lên : 21/02/2014, 01:21
... Morphological and phenotypic characterization Physiological and biochemical parameters, such as Gram reaction, flagella type, catalase activity, oxidase activity and OF test, were determined using classical ... REFERENCES Fujisawa, H & Hayaishi, O (1968) Protocatechuate 3,4-dioxygenase I Crystallization and characterization J Biol Chem 243, 2673–2681 Murakami, S., Nakanishi, Y., Kodama, N., Takenaka, S., Shinke, ... sucrose Alkali was produced from L-asparagine, citrate, galactarate and tartrate The nucleotide sequence (1457 bp) of the 16S rRNA gene of strain 10d was 96.7% identical with that of Bordetella avium...
  • 7
  • 490
  • 0
Peptidylarginine deiminase (PAD) is a mouse cortical granule protein that plays a role in preimplantation embryonic development docx

Peptidylarginine deiminase (PAD) is a mouse cortical granule protein that plays a role in preimplantation embryonic development docx

Ngày tải lên : 05/03/2014, 17:20
... the ABL2 antibody and that PAD (ABL2 antigen, p75) is present in the cortical granules of mouse oocytes Localization of PAD (p75) after artificial activation and fertilization To demonstrate that ... released PAD and ABL2 antigen (p75) on the oocyte's surface B and F are artificially activated oocytes treated with a high salt solution that removed PAD and p75 from oocytes' surfaces C and G are ... (SignalP V2.0 and TargetP V1.0) [35-37] were used to determine that a putative signal peptide and a cleavage site exist in ePAD and AAH53724 (an egg and embryo abundant peptidylarginine deiminase),...
  • 22
  • 519
  • 0
Adviceguide Advice that makes a difference pptx

Adviceguide Advice that makes a difference pptx

Ngày tải lên : 07/03/2014, 11:20
... signing any document that states that you have examined the car and found it satisfactory in all respects Guarantee or extended warranty If the car was sold with a guarantee or an extended warranty, ... you may have additional rights The guarantee or warranty cannot take away your statutory rights You should check the small print on your warranty Many have exclusions such as wear and tear If ... going back to the dealer  contact the dealer and the finance company (if applicable) as soon as you discover the fault Take the car back, and ask to speak to a manager or the owner Alternatively,...
  • 7
  • 366
  • 0
Báo cáo khoa học: New members of the brachyurins family in lobster include a trypsin-like enzyme with amino acid substitutions in the substrate-binding pocket potx

Báo cáo khoa học: New members of the brachyurins family in lobster include a trypsin-like enzyme with amino acid substitutions in the substrate-binding pocket potx

Ngày tải lên : 23/03/2014, 03:20
... 5¢-GGACATCTCCTTCGGCTT-3¢ 5¢-AGTGACCAGCACAGATAGC-3¢ 5¢-GTGGATCCAGTGTTCGTCAT-3¢ 5¢-CCGTGCCCATCGTGTCTGA-3¢ 5¢-CCAGTAGACAAACCACTTCG-3¢ 5¢-CATACCTGGCTTCAAGATGC-3¢ 5¢-CAGGAATTGCCGATAGGATGC-3¢ 5¢-TACTTGCGTTCAGGGGGAGC-3¢ ... acids ⁄ 237 acids ⁄ 237 acids ⁄ 237 acids ⁄ 237 acids ⁄ 249 amino amino amino amino amino 266 266 266 266 278 AATAAA ⁄ 13 nucleotides AATAAA ⁄ 13 nucleotides AATAAA ⁄ 10 nucleotides AATAAA ⁄ 13 nucleotides ... APSRKPTFRRGLNK APSRRLRFPPNNYK GU338026 GU338028 GU338029 GU338030 CAA60129 CAA75310 CAA75311 CAA10915 Present study MKSLVLCLLLAGAFA MKTLVLCVLVAGAFA KFVCTLLFLVVAANA -FVCALFFLAVAASA -FVCALFFLAVAASA APSRKPTFRRGLNK...
  • 13
  • 474
  • 0
Báo cáo khoa học: A designed curved DNA segment that is a remarkable activator of eukaryotic transcription potx

Báo cáo khoa học: A designed curved DNA segment that is a remarkable activator of eukaryotic transcription potx

Ngày tải lên : 23/03/2014, 10:20
... TTTTTCAGTCAGTTTTTCAGTCAGTTTTTCAC-3¢ and 5¢-GTGAAAAACTGACTGAAAAACTGACTGAAAAAC TGACTGAAAAACTGA-3¢ were annealed to generate a dsDNA fragment, which we named T4-R¢¢ T4-R¢¢ was inserted into the PmaCI site ... obtained by annealing oligonucleotides 5¢-GTTTTTCATG TTTTTCATGTTTTTCATGTTTTTCAC-3¢ and 5¢-GTG AAAAACATGAAAAACATGAAAAACATGAAAAAC-3¢, Synthetic oligonucleotides 5¢-TCAGTTTTTCAGTCAG TTTTTCAGTCAGTTTTTCAGTCAGTTTTTCAC-3¢ ... Designed DNA as an activator of transcription N Sumida et al transient transfection assay system, at a specific rotational phase and distance between T4 and the promoter [12] We concluded that T4 formed...
  • 12
  • 399
  • 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Ngày tải lên : 23/03/2014, 13:20
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
  • 11
  • 679
  • 0
Báo cáo khoa học: Nuclear aggregates of polyamines are supramolecular structures that play a crucial role in genomic DNA protection and conformation potx

Báo cáo khoa học: Nuclear aggregates of polyamines are supramolecular structures that play a crucial role in genomic DNA protection and conformation potx

Ngày tải lên : 23/03/2014, 15:20
... Saminathan M, Thomas T, Shirahata A, Pillai KS & Thomas TJ (2002) Polyamine structural effects on the induction and stabilization of liquid crystalline DNA, potential applications to DNA packaging, ... cycle, particularly the S-phase [21] Temperature is an additional factor capable of affecting DNA conformation It has been reported that (a) an increase of a few °C is associated with a reduction ... modelling was carried out, producing molecular structures that were in strict accordance with biochemical data and theoretical rationales All biochemical data were collected from analytical, electrophoretic...
  • 11
  • 380
  • 0
MẪU THÔNG TIN ĐĂNG KÝ THẤT NGHIỆP A. THÔNG TIN VỀ NGƯỜI LAO ĐỘNG ĐĂNG KÝ THẤT NGHIỆP docx

MẪU THÔNG TIN ĐĂNG KÝ THẤT NGHIỆP A. THÔNG TIN VỀ NGƯỜI LAO ĐỘNG ĐĂNG KÝ THẤT NGHIỆP docx

Ngày tải lên : 25/03/2014, 07:21
... ch a bệnh (kể trường hợp cai nghiện Trung tâm cai nghiện) chấp hành hình phạt tù không hưởng án treo theo mẫu số 21 ban hành kèm theo Thông tư số /201…/TT-BLĐTBXH ngày tháng………năm 201……… Bộ Lao ... quy định thời gian hưởng trợ cấp thất nghiệp Thông báo cho Trung tâm Giới thiệu việc làm nơi hưởng trợ cấp thất nghiệp có việc làm, nhận định hưởng lương hưu tháng, thực ngh a vụ quân sự, nước ... 1 Đăng ký thất nghiệp Trung tâm Giới thiệu việc làm thuộc Sở Lao động - Thương binh Xã hội việc chấm dứt hợp đồng lao động hợp đồng làm việc; nộp hồ sơ hưởng bảo hiểm thất nghiệp theo...
  • 2
  • 605
  • 0
All the World’s a Cage: Animal Entertainment pdf

All the World’s a Cage: Animal Entertainment pdf

Ngày tải lên : 30/03/2014, 14:20
... orphan brought back by the Davis family from a vacation in Africa The story didn’t share that almost all baby chimps acquired from Africa are orphans As with elephants and orcas, a living mother ... research program, and one of the chimps, Sarah, was housed with Oliver People volunteering at the sanctuary, while worried about Sarah having been separated from her group, said that she had been ... billed as “the Missing Link,” or as a “humanzee,” the billing due mostly to his humanlike two-legged walk He also had less facial hair and what is considered to be a more human-shaped head than most...
  • 5
  • 492
  • 0
Báo cáo khoa học: "GENERATING A SPECIFIC CLASS OF METAPHORS" pptx

Báo cáo khoa học: "GENERATING A SPECIFIC CLASS OF METAPHORS" pptx

Ngày tải lên : 31/03/2014, 06:20
... hierarchy towards the position that humans occupy 4.1 General Approach The idea behind the approach is to identify related domains of the tenor domain that are appropriate as metaphorical domains ... of abstraction, where the key role (termination) is specified, we can search for a candidate metaphorical domain that shares this ancestor There are several possible metaphorical domains that ... tenor and metaphorical domains share some roles that are defined by their common ancestor in the "isa" hierarchy Specifically, we require that they share the role that is the focus of the metaphor...
  • 3
  • 267
  • 0
the nothing that is, a natural history of zero - robert kaplan

the nothing that is, a natural history of zero - robert kaplan

Ngày tải lên : 05/06/2014, 11:23
... karikara, vivara, achobya, vivaha, utsanga, bahula, nagabala, titilambha, vyavaithanaprajnapti (! that' s 1031), and so through the alluring samaptalambha (1037) and the tongue-twisting visandjnagati ... and 1087, you have to say that Archimedes' estimate wasn't all that bad This is a spectacular application of the Greek insight that the world afar can be grasped by analogy to the world at hand ... Oda, Larry Pfaff, Donald Ranee, Andrew Ranicki, Aamir Rehman, Abdulhamid Sabra, Brian A Sullivan, Daniel Tenney III, Alf van der Poorten, Jared Wunsch, Michio Yano and Don Zagier Finally, I can't...
  • 238
  • 5.2K
  • 0