find the maximum value in a range vba excel

Expect the Unexpected: Building business value in a changing world pptx

Expect the Unexpected: Building business value in a changing world pptx

... industrial. Agriculture in India, sub-Saharan Africa, and Asia (excluding China) is forecast to create the most additional water demand to 2030. In China, industrial demand for water will dominate ... been taking place at several times the natural replacement rate, the amount of available arable land per person has dropped substantially and agricultural productivity has slowed. At the same ... each other in predictable ways. They act as a complex and unpredictable system, feeding, amplifying or ameliorating the effects of others. Business leaders seeking to manage the risks and...

Ngày tải lên: 15/03/2014, 21:20

180 413 0
Tài liệu Controlling the Names Used in a Strongly Typed DataSet pdf

Tài liệu Controlling the Names Used in a Strongly Typed DataSet pdf

... used. In either case, data is loaded into the DataSet and the collections of rows and columns in the DataSet are iterated over to display the data and to demonstrate the effect of the schema annotations. ... TableNameDataTable typedPlural DataTable methods NewTableNameRowAddTableNameRowDeleteTableNa meRow typedName DataRowCollect ion TableName typedPlural DataRow TableNameRow typedName DataColumn DataTable.ColumnNameColumnDataRow.ColumnName ... available annotations for each. Table 2-18. Default values and available annotations for elements of strongly typed DataSet objects Element Default name Annotatio n DataTable TableNameDataTable...

Ngày tải lên: 24/12/2013, 05:15

5 390 0
Tài liệu Limit the Data Displayed in a Bound List Box doc

Tài liệu Limit the Data Displayed in a Bound List Box doc

... contained within the OleDbDataAdapter control will query against to limit the data displayed in the list box. A command button will be added to allow you to call the Fill method of the OleDbDataAdapter ... parameter of the OleDBDataAdapter1, which was created by using the ? in the Select statement of 1.2 Limit the Data Displayed in a Bound List Box Even populating a list box with a couple of ... your form and start a new one as described at the beginning of the steps for this one, you have the instructions there. Otherwise, by the time you reach How-To 1.8, you will have a data entry...

Ngày tải lên: 21/01/2014, 12:20

4 323 0
Tài liệu Organic matter distribution of the root zone in a constructed subsuface flow wetland pptx

Tài liệu Organic matter distribution of the root zone in a constructed subsuface flow wetland pptx

... operation and maintain as well (Watson and Hobson, 1989, Kadlec and Knight, 1996, Mitsch and Gosselink, 2000). They form one possible promising and feasible approach for a small scale decentralized ... precipitation processes in the soil and by microbiological degradation. Finally, the treated wastewater flows out in the bed. The wastewater is therefore not causing any odour or mosquito breeding ... translated a new insight to adjusted design parameter of constructed wetland in tropical countries for domestic wastewater treatment. The linear decreasing OM distribution to the increasing...

Ngày tải lên: 24/01/2014, 00:20

6 474 0
Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner doc

Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner doc

... C 6)12 fatty acids We purified the recombinant O-MACS protein to exam- ine whether it has an acyl-CoA synthetase activity like other MACS family proteins. The recombinant plasmid carrying either the ... 5¢-cttcctgtgtcaagtggcag-3¢ (for- ward), 5¢-gttggcagtggcattcacga-3¢ (reverse); and NeuroD 5¢-aagacgcatgaaggccaatg-3¢ (forward), 5¢-catgatgcgaatggct atcg-3¢ (reverse). Hybridization, washing, antibody reaction and ... figures. The o-macs transcripts are detected in all cell layers; supporting cell layer (s), OSN layer (n), basal layer (b), and lamina propria (lp). The o-macs mRNA was not detected in the apical (a) ...

Ngày tải lên: 08/03/2014, 02:20

10 394 0
Risks Ahead for the Financial Industry in a Changing Interest Rate Environment pdf

Risks Ahead for the Financial Industry in a Changing Interest Rate Environment pdf

... that bank balance sheets “remain fragile and capital buffers may still be inadequate in the face of further increases in nonperforming loans.” 3 2. Interest rate risk, exchange rate risk and ... such data are not available for Saudi Arabia. b) From 1-Jan-10 to 29-Jul-10. c) Based on banks contained in respective countries' Datastream bank indices. d) Based on banks in Datastream ... the remaining weaknesses of these economies, while inflation pressures (as RISKS AHEAD FOR THE FINANCIAL INDUSTRY IN A CHANGING INTEREST RATE ENVIRONMENT 18 OECD JOURNAL: FINANCIAL MARKET TRENDS...

Ngày tải lên: 15/03/2014, 01:20

18 385 0
How to attract interests and involvement of the 9th graders in a speaking lessons at Minh Thanh secondary in Quang Ninh

How to attract interests and involvement of the 9th graders in a speaking lessons at Minh Thanh secondary in Quang Ninh

... mother tongue if they are grouped with those having the same language, and particularly talking in small groups because they find it easier and more natural to speak their mother tongue than ... speaking in general and teaching speaking in particular. In the Chapter 2, we will investigate how speaking lessons are dealt with by teachers and students in Minh Thanh secondary school in ... the class into two teams and play some kind of game. You could have the left side of the room against the right side, boys against girls, or each row against all the others. Competition can...

Ngày tải lên: 15/03/2014, 10:03

119 527 1
Báo cáo khoa học: LIN54 is an essential core subunit of the DREAM / LINC complex that binds to the cdc2 promoter in a sequence-specific manner ppt

Báo cáo khoa học: LIN54 is an essential core subunit of the DREAM / LINC complex that binds to the cdc2 promoter in a sequence-specific manner ppt

... D ATTTGAACTGTGCCAGGACTGGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGAGAGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGAAGGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAAGGAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAGGGATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAGGGTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAATTGGGGATCT Mut ... MYB1 ATTTGAACTAGACCAATGCTGGGAGAAAAAATTTAAGATCT Mut A ATTTGAACTGTGAAGATGCTGGGAGAAAAAATTTAAGATCT Mut B Mut C Mut D ATTTGAACTGTGCCAGGACTGGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGAGAGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGAAGGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAAGGAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAGGGATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAGGGTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAATTGGGGATCT Mut ... 5¢-GGCGGATCCAAGCCAGTGGTTGTTAAT AC-3¢ and 5¢-GCCTCGAGAATCAAGTGTCCCTGCACC T-3¢ (LIN-54-DN); 5¢-GCGGATCCGAGGTGGTGCCAG CTGAG-3¢,5¢-GCTCTAGAGAATGGAAGCCGTGCCT G-3¢,5¢-GCTCTAGATTGGCAGATGCAGCTGAAGTA- 3¢ and 5¢-GCCTCGAGAATCAAGTGTCCCTGCACCT-3¢ (LIN-54-DCXC);...

Ngày tải lên: 23/03/2014, 04:20

14 456 0
The Reproductive Value in Distributed Optimal Control Models potx

The Reproductive Value in Distributed Optimal Control Models potx

... consists of the marginal costs of an additional infected individual, as well as the (negative) value the infected value assumes due to increasing the age-interaction between risky individuals. The indirect ... ξ Y (a, t), η Q (t)andζ (a, t) are the adjoint variables of Y , Q and P respectively. All adjoint variables can be interpreted as dynamic shadow prices, i.e. they indicate the increase of the objective ... if the corresponding state is increased marginally. E.g. ξ N (a, t) denotes the increase of the objective function if the population is increased marginally at age a at time t (or by one a- aged...

Ngày tải lên: 28/03/2014, 16:20

20 301 0
The Canadian Economy in a Global Setting pptx

The Canadian Economy in a Global Setting pptx

... 42 What and With Whom What and With Whom Canada Trades Canada Trades  Balance of trade – the difference between the value of exports and the value of imports  Balance of trade contains ... 58 International Economic International Economic Policy Organizations Policy Organizations  Governmental international organizations that encourage international cooperation include:  The ...  There are also informal organizations such as:  The Group of Five (Japan, Germany, Britain, France, and the U.S.) which meets to promote negotiations and coordinate economic relations among nations. ©...

Ngày tải lên: 29/03/2014, 17:20

62 483 0
LORD NEUBERGER OF ABBOTSBURY, MASTER OF THE ROLLS JUSTICE IN A TIME OF ECONOMIC CRISIS AND IN THE AGE OF THE INTERNET ppt

LORD NEUBERGER OF ABBOTSBURY, MASTER OF THE ROLLS JUSTICE IN A TIME OF ECONOMIC CRISIS AND IN THE AGE OF THE INTERNET ppt

... of law. In the same way, just as it is not only essential that we maintain ourselves as a liberal democratic society as an aim in itself, but, by doing so, we will ensure that we can maintain ... have all played an important part in our legal history. Given the entrepreneurial nature of its lawyers, they are playing an important part today, and I am sure they will continue to play an ... justice and humanity of the law . . .’ 13 33. It may be difficult to ensure that that bargain could be maintained by entirely virtual hearings. It may be hard to maintain the seriousness of litigation...

Ngày tải lên: 31/03/2014, 03:20

16 469 0
Measuring the Economic Value of a City Park System docx

Measuring the Economic Value of a City Park System docx

... pollution the fact that park trees and shrubs absorb a variety of air pollutants. In the following chapters, after describing the value factor and the rationale for calculating it, we provide a real-life ... Basin, the stately elms gracing the Reflecting Pool, and massive oaks of Lafayette Park, there are 4,839 acres of general tree cover in the city’s 7,999 acres of parkland. Their aesthetic value ... in 2005. Based on the dollar values assigned to these pollutants, the savings was $1,130,000. PARK VALUE IN ACTION Cutting Air Pollution Costs in Washington, D.C. Total Pollutant Removal Value $9,089 $267,572 $512,771 $287,709 $53,246 $19,871,863...

Ngày tải lên: 02/04/2014, 08:20

28 386 0
báo cáo hóa học:" Medial pelvic migration of the lag screw in a short gamma nail after hip fracture fixation: a case report and review of the literature" potx

báo cáo hóa học:" Medial pelvic migration of the lag screw in a short gamma nail after hip fracture fixation: a case report and review of the literature" potx

... these frac- tures, with majority of them belonging to either the intrameduallary or the sliding hip plate category. The advantages of intrameduallary fixation system are decreased intra-operative ... externally rotated right lower extremity that was painful to log-roll and axial load. Otherwise the patient was neurovascu- larly intact. The initial radiographs showed a 3- part inter-trochanteric ... Heffernan, Christina Kane, Walter Leclair Abstract Hip fractures are a common injury among the elderly. Internal fixation with an intramedullary (IM) system has gained popularity for the treatment...

Ngày tải lên: 20/06/2014, 04:20

7 465 0
báo cáo hóa học:" Medial pelvic migration of the lag screw in a short gamma nail after hip fracture fixation: a case report and review of the literature" pot

báo cáo hóa học:" Medial pelvic migration of the lag screw in a short gamma nail after hip fracture fixation: a case report and review of the literature" pot

... setting of an unstable fracture pattern, there was togg ling of the nail within the intrameduallary canal which led to the medial migration of the Lag Screw with repeated axial loading. This is the ... shortened and externally rotated right lower extremity that was painful to log-roll and axial load. Otherwise the patient was neurovascu- larly intact. The initial radiographs showed a 3- part inter-trochanteric ... sliding hip plate category. The advantages of intrameduallary fixation system are decreased intra-operative blood los s and operating room time with immediate load-bearing. Better clinical out- comes...

Ngày tải lên: 20/06/2014, 07:20

7 477 0
Báo cáo hóa học: " On the maximum modulus of a polynomial and its polar derivative" potx

Báo cáo hóa học: " On the maximum modulus of a polynomial and its polar derivative" potx

... Rather, NA: A refinement of a theorem of Paul Turan concerning polynomials. Math Ineq Appl. 1, 231–238 (1998) 7. Jain, VK: Generalization of an inequality involving maximum moduli of a polynomial and ... possible and equality attains for p(z)=(z -1) n with a ≥ 1. As an extension to the inequality (1.7), Jain [7] proved that if p(z) has all zeros in |z| ≤ 1, then for all a 1 , a t Î ℂ with |a 1 | ... the maximum modulus of a polynomial and its polar derivative Ahmad Zireh Correspondence: azireh@shahroodut.ac.ir Department of Mathematics, Shahrood University of Technology, Shahrood, Iran Abstract For...

Ngày tải lên: 20/06/2014, 22:20

9 423 0
w