... C-terminus GGFFGRVWDFVMMKFHHWFGSWFS-COO 0.51 0.42 ) ) + ) ++ + ) PBP6b C-terminus LVTLESVGEGSMFSRLSDYFHHKA-COO ) ) ) 0.59 )0.03 HA2 fusion peptide GLFGAIAGFIENGWEGMIDG 0.65 0.23 Ó FEBS 2002 Membrane ... resulting from neighboring bands Similar to the deconvolution technique, the bandshapes of the single components are superpositions of Gaussian and Lorentzian bandshapes Best fits were obtained by assuming ... FTIR spectroscopy was used to perform conformational analyses of P4 and P5 either in aqueous solution or in the presence of SUVs A typical overview spectrum for these peptide–lipid systems is shown...
Ngày tải lên: 31/03/2014, 08:20
... phosphines useful in aqueous organometallic catalysis These Ligands used for aqueous organometallic catalysis 19 phosphides can be generated in reactions of Li, K or Na with phosphorus halides (e .g ... hydrolysis of some alkene derivatives (e .g acryl esters) a small amount of was used as base, and a small quantity of ditertbutylphenol was Ligands used for aqueous organometallic catalysis 21 added ... compounds in the following Figures Ligands used for aqueous organometallic catalysis 2.9 39 SOLUBILITIES OF TERTIARY PHOSPHINES AND THEIR COMPLEXES IN WATER Water-soluble phosphines most often used...
Ngày tải lên: 13/12/2013, 14:15
Tài liệu Readability and Patient Education Materials Used for Low-Income Populations pptx
... level; agreement was 100% The Statistical Package for the Social Sciences (version 15.0 for Windows) was used for data analysis Measures of central tendency were calculated for all PEMs using FleschKincaid, ... reading level using all measures All PEMs (those produced commercially and in-house) must be assessed for appropriate reading levels using set criteria and measures The accessibility and ease of use ... literacy assessment instrument when compared with WRAT-R and consists of items taking less than minutes to administer.42 The Newest Vital Sign (NVS) is another literacy assessment test that was developed...
Ngày tải lên: 14/02/2014, 14:20
Tài liệu Đề tài " Boundary regularity for the Monge-Amp`ere and affine maximal surface equations " docx
... holds Continuity estimates for second derivatives Our passage to C estimates at the boundary uses a modulus of continuity estimate for second derivatives proved by Caffarelli, Nirenberg, and Spruck ... convex solution is of good shape; that is, it lies between two concentric balls whose radii ratio is controlled This is not possible for sections centered on the boundary and most of our proof is ... this case Note that the operator L in (1.4) possesses much stronger invariance properties than its Monge -Amp` re counterpart (1.1) in that L is invariant under e unimodular affine transformations...
Ngày tải lên: 16/02/2014, 06:20
Herbal Formulations from Cold Desert Plants Used For Gynecological Disorders pptx
... freshness Usually Amchi not discuss the quantity of different plants and other materials used in formulation of reme- Discussion Frequency of exotic plants used The most frequently used exotic species ... plant parts, animal products, as well as, medicinal ores/ stones and mineral salts for gynecological disorders The Amchi system of medicine is still used by the majority of the indigenous population ... formulations used, different categories of gynecological disorders treated, various plant parts used, form of preparations, and mode of administration All of the formulations were prepared as...
Ngày tải lên: 22/03/2014, 11:20
Low-Iodine Cookbook: Guidelines and Tips for the Low-Iodine Diet Used for a Short Time When Preparing To Receive Radioactive Iodine docx
... on molasses labels Some diets don't make distinctions between kinds of molasses and say to avoid all molasses One diet allows all molasses • Soybeans and most soy products (soy sauce, soy milk, ... following few days It is just as delicious cold Sometimes finding recipes for the low-iodine diet is as easy as going through your favorites and making some minor changes Thanks for ThyCa s great ... cancer specialist physicians • These guidelines combine the recommendations of several thyroid cancer specialists whose patients have successfully used their guidelines • Some guidelines say just...
Ngày tải lên: 22/03/2014, 16:21
Indigenous medicine used for treatment of gynecological disorders by tribal of chhattisgarh, India pptx
... days Karghi, Satavar Asparagus racemosus Tuber and stem Excess Bleeding during menstrual discharge and burning sensation in urine Fresh and Dried root or stem is soaked in a glass of water for one ... of 50gms Ramdatoon, 50 gms Nagarmotha (Cyprus rotandus), 50gms Aonla (Emblica officinalis), 50 gms Padhmool, 25 gms Tripatri and 50 gms Mishri (recrystalised cane sugar) is prepared Half spoon ... Shukla et al Table Plants used for gynecological disorders in Chhattisgarh Local Name Botanical Name Part Used Disease Method of Preparation Doses Local Name Botanical Name Part Used Disease...
Ngày tải lên: 28/03/2014, 14:20
Báo cáo hóa học: " Modulation of the major histocompatibility complex by neural stem cell-derived neurotrophic factors used for regenerative therapy in a rat model of stroke" ppt
... NT-3 (forward: 5′-GAT CTT ACA GGT GAA CAA GGT GAT G- 3′, reverse: 5′-TTG ATC CAT GTT GTT GCC TTG-3′) and the house keeping gene b-actin (forward: 5′-CTA CAA TGA GCT GCG TGT GG-3′, reverse:5′-CAG TCA ... analyzed using SPSS software version 11.5 (SPSS, IL, http://www.spss.com) Differences between groups were regarded as significant if p ≤ 0.05 Results Primary NSC cultures Primary cells segregated ... visualized using HistostainTM-SP kit and the manufacturer s protocol (Zhongshan Beijing, China, http:// gjj.cc/nongye/shengwugongcheng/zsbio.htm) Statistical Analysis Results are expressed as mean ± standard...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo nghiên cứu khoa học " Strategy for Distribution of Improved Seed by Research Centre for Forest Tree Improvement (RCFTI), Vietnam " pdf
... projects User s x District Agri & Forestry Section Forest Industries Technology transfer x Provincial DARD Forest research institutions Nursery x x x x x x 10 Issues associated with diffusion of genetically ... Program and in charge of policy, strategy issues and organising and guiding on: • Establishment of seed stands and nurseries • Production and utilisation of seedlings to ensure stable and sufficient ... sources • Seed supplier • Production of seedlings and cuttings • User of seed and seedlings • Extension service Forest Research Institutions MARD s Department of Science and Technology advises the...
Ngày tải lên: 22/06/2014, 12:20
Advertising for ResultsBy G.F. Brown.Advertising for Results Legal notice Advertising pot
... ads, because you need to get big results fast Let s go Advertising for Results Chapter Gathering Chapter Gathering The blank screen You have an advertising assignment of some sort If you’re sitting ... Heights All rights are reserved Advertising for Results For my wife Advertising for Results “It is the dry and irksome labor of organizing precincts and getting out the voters that determines ... you sift through the piles of everythings Modify your assessments as you learn more 10 Advertising for Results Chapter Gathering Understanding the ununderstandable Let s say you’re reading gobbledygook...
Ngày tải lên: 28/06/2014, 12:20
Section X - Drugs Used for Immunomodulation doc
... arthritis, diabetes mellitus, systemic lupus erythematosus, and multiple sclerosis; solid tumors and hematologic malignancies; infectious diseases; asthma; and various allergic conditions Furthermore, ... because there are numerous steroid-responsive tissues and genes, the extensive use of steroids has resulted in disabling and life-threatening adverse effects in many patients These effects include ... lymphokines) that perform as effectors and regulators of the immune response The impact of the immune system in human disease is enormous Developing vaccines against emerging infectious agents from...
Ngày tải lên: 12/07/2014, 20:21
Báo cáo lâm nghiệp: "Findings from the application of coal combustion by-products (CCB) for forest reclamation on spoil banks of the North Bohemian Brown Coal Basin" pdf
... of soil properties of Anthroposols and growth vitality of the forest tree species plants: the assessment of texture, chemical and other soil properties of Anthroposols was done on the basis of ... Anthroposols Growth vitality of evaluated taxa of forest tree species: generally, irrespective of the evaluated reclamation treatments (“A”, “B”), the highest losses as a P Results and Discussion ... nutrients the content of phosphorus is low, that of potassium is high to very high, of magnesium very high and calcium content is good to high As a result of CCB ploughing-in into the soil horizon formed...
Ngày tải lên: 07/08/2014, 10:21
Báo cáo vật lý: "WATER QUALITY RESPONSE TO CLEAR FELLING TREES FOR FOREST PLANTATION ESTABLISHMENT AT BUKIT TAREK F.R., SELANGOR" doc
... time series, such as water quality data often possess characteristic, which not allow the series to be easily analysed statistical techniques.16 This was due to the missing data observation caused ... Quality Response to Clear Felling Trees 34 water from forested areas is associated with improperly designed and maintenance of logging roads This situation is further aggravated by the intensity and ... values before logging, during logging and after logging for the three catchments The average trend in pH slightly increased during felling period Based on the data observation, clear felling activities...
Ngày tải lên: 07/08/2014, 14:20
Báo cáo vật lý: "ON COUNTING CERTAIN PERMUTATIONS USED FOR SPEECH SCRAMBLING" pps
... On Counting Certain Permutations Used for Speech Scrambling 132 The following are examples of permutations that can minimize RI: • C1 (Derangements) permutations whose elements are displaced from ... m + On Counting Certain Permutations Used for Speech Scrambling 136 The permutations in class I are those permutations in class II and III which fix m + The following theorems give the number ... SHIFT FACTOR High shift factor is essential for ensuring minimum or zero RI, since the permutations with high shift factor displaces the elements much farther If the shift factor is taken to be...
Ngày tải lên: 07/08/2014, 14:20
Báo cáo lâm nghiệp: "A fire probability model for forest stands in Catalonia (north east Spain)" pot
Ngày tải lên: 07/08/2014, 16:20
Báo cáo lâm nghiệp: "New insights in the recognition of the European ash species Fraxinus excelsior L. and Fraxinus angustifolia Vahl as useful tools for forest management" pdf
... primers used Name2 and sequence (5’→3’) Position1 Size Tm ◦ GC (mers) FaH299F GGAAGTCGCCCTTAGACTTTG FaH299R GCCAAATGGCCTTACACAAC FaL757F CAGCTTGGTGAGCGATCC FaL757R CCAGCAGCTTCACAAGGTTA FaH1549F GAAGTCGCCGCTATCAAGTAA ... in seed lots, which could be easily applied by forest managers The present set of markers allows us to distinguish the two species adequately and this discrimination improves with increasing sample ... produces more vigorous seedlings during the first years of growth (Dufour, unpublished results) This could represent a better ability for colonizing newly open forest gaps or open habitats, and thus...
Ngày tải lên: 07/08/2014, 16:20
Báo cáo khoa học: "The 23S rRNA gene PCR-RFLP used for characterization of porcine intestinal spirochete isolates" pptx
... ehT eniws yhtlaeh morf detalosi eb osla nac yeht ,revewoh ;DS morf gnireffus eniws fo snemiceps lanitsetni morf detalosi yltneuqerf era setehcorips lanitsetnI noissucsiD )3 giF( detareneg saw eert ... stluseR )adanaC ,tfoSoiB nonnyL( NAMAND gnisu detcurtsnoc saw eert cinegolyhp a dna dengila erew secneuqeS dohtem TSALB eht gnisu detide dna delbmessa erew atad gnicneuqeS )ASU ,smetsysoiB deilppA ;rezylanA ... citeneG 0013 MSIRP IBA( recneuqes AND detamotua na no demrofrep erew snoitcaer gnicneuqes AND sleg esoraga %3 no dezilausiv erew stnemgarf detsegiD snoitcurtsni s rerutcafunam eht ot gnidrocca )ASU...
Ngày tải lên: 07/08/2014, 18:21
Báo cáo lâm nghiệp: " Consequences of increased deer browsing winter on silver fir and spruce regeneration in the Southern Vosges mountains: Implications for forest management" potx
... Understorey corering seedlings Time of the last cut NS NS NS NS NS NS NS NS absent south* Ground flora NS NS fir 10–70 cm Stand composition NS > 50%*** NS NS NS NS NS fir-spruce Bl NS (2) NS NS NS ... flora Understorey density Understorey corering seedlings Time of the last cut NS Elevation NS NS NS NS NS NS NS NS NS > 22%*** NS spruce*** NS NS NS NS mixed*** NS NS NS NS Chi-square test: *** ... consequence of strong browsing pressure localised in highlyattractive places during winter, such as South-facing slopes Repeated fir browsing favours spruce because it affects the establishment, growth...
Ngày tải lên: 08/08/2014, 00:21
Báo cáo lâm nghiệp: "A fire probability model for forest stands in Catalonia (north-east Spain)" pptx
... stands with different stand structures Of these, the probability was the lowest for the sparse stand resembling a mature stage, and highest for the twolayered stand of Figure 5f The stands in Figures ... model represented easily measurable forest characteristics such as elevation, tree size, structure and species composition Some of these variables, namely stand structure and species composition ... several forest stand characteristics on the probability of fire The parameters of these predictors support previous knowledge which states that stands resembling mature sparse even-aged forests have...
Ngày tải lên: 08/08/2014, 00:22