figure52 components of a disk platter

List the components of a radio system

List the components of a radio system

... – Advantages • Can carry up to three times the amount of data as TDMA • Transmissions are much harder to eavesdrop on • A would-be eavesdropper must also know the exact chip in which the transmission ... the signal • Attenuation – A loss of signal strength • Multipath distortion – As a radio signal is transmitted, the electromagnetic waves spread out 24 Signal Strength (continued) 25 Radio Frequency ... • List the components of a radio system • Describe how different factors affect the design of a radio system • Explain the radio frequency spectrum Components of a Radio System • Components include:...

Ngày tải lên: 13/09/2012, 10:52

30 922 0
Novel design of a disk-shaped compacted micro-structured air-breathing PEM fuel cell

Novel design of a disk-shaped compacted micro-structured air-breathing PEM fuel cell

... distribution patterns of activation overpotentials are similar, with higher values at the catalyst layer near the air inlet area It can be seen that the activation overpotential profile correlates with ... Mechanical behaviour of PEM fuel cell catalyst layers during regular cell operation International Journal of Energy and Environment, 2010; 1(6), 927-936 [16] Maher A. R Sadiq Al-Baghdadi A CFD analysis ... performance and design of air-breathing PEM fuel cells Litster and Djilali [1] developed a single-phase one-dimensional semi-analytical model of the membrane electrode assembly (MEA) of planar air-breathing...

Ngày tải lên: 05/09/2013, 14:58

20 521 0
Tài liệu Lab 5.2.3 Building a Basic Routed WAN ppt

Tài liệu Lab 5.2.3 Building a Basic Routed WAN ppt

... with an RJ45 Ethernet or Fast Ethernet interface (or an AUI interface) and at least one serial interface • 10Base-T AUI transceiver (DB15 to RJ45) for a router with an AUI Ethernet interface, ... table Note that the IP address of each PC is on the same network as the default Gateway, which is the Ethernet interface of the connected router The default Gateway is required on local area ... serial cables available in the lab Depending on the type of router and/or serial card, the router may have different connectors b Router serial port characteristics 3-7 CCNA 1: Networking Basics...

Ngày tải lên: 11/12/2013, 14:15

7 474 1
Tài liệu Lab 5.2.3b Building a Basic Routed WAN pdf

Tài liệu Lab 5.2.3b Building a Basic Routed WAN pdf

... with an RJ-45 Ethernet or Fast Ethernet interface (or an AUI interface) and at least one serial interface • 10BASE-T AUI transceiver (DB-15 to RJ-45) for a router with an AUI Ethernet interface, ... that the IP address of each PC is on the same network as the default gateway, which is the Ethernet interface of the connected router The default gateway is required on local area networks that ... or lab assistant to have the correct IP addresses on their LAN and WAN interfaces Router A will provide the clocking signal as DCE Start this lab with the equipment turned off and with cabling...

Ngày tải lên: 11/12/2013, 14:15

8 440 0
Tài liệu Lab 5.2.7 Establishing a Console Connection to a Router or Switch docx

Tài liệu Lab 5.2.7 Establishing a Console Connection to a Router or Switch docx

... serial interface on the PC or dumb terminal is a DB-25, an RJ-45 to DB-25 adapter will be needed Both of these adapters typically come with a Cisco router or switch Step Locate or build a rollover ... labeled serial or COM1 It may or may not be identified Step Locate the RJ-45 to DB-9 adapter One side of the adapter connects to the PCs serial interface and the other to the RJ-45 rollover cable connector ... build a rollover cable Use a rollover cable If necessary, make one of adequate length to connect the router or switch to a workstation 2-6 CCNA 1: Networking Basics v 3.0 - Lab 5.2.7 Copyright...

Ngày tải lên: 21/12/2013, 19:15

6 476 0
Báo cáo khoa học: Characterization of the 5¢ untranslated region of a and b isoforms of the human thromboxane A2 receptor (TP) Differential promoter utilization by the TP isoforms doc

Báo cáo khoa học: Characterization of the 5¢ untranslated region of a and b isoforms of the human thromboxane A2 receptor (TP) Differential promoter utilization by the TP isoforms doc

... rates [29], stimulation of apoptosis of immature thymocytes [30] TXA2 has been implicated as a mediator of a number of vascular disorders including thrombosis, unstable angina, myocardial infarction, ... Kinase reporter vectors and Dual LuciferaseÒ Reporter Assay System were obtained from Promega Corporation, Madison, WI, USA Taq DNA polymerase, T4 DNA ligase and calf intestinal alkaline phosphatase ... substantial variations in the relative levels of expression of TPa and TPb mRNAs in a variety of human tissues; whereas TPa mRNA levels remains constant between cell types, the levels of TPb vary...

Ngày tải lên: 31/03/2014, 09:20

16 321 0
Báo cáo khoa học: "Structural and functional characterization of the 5’ upstream region of a glutamine synthetase gene from Scots pine" pdf

Báo cáo khoa học: "Structural and functional characterization of the 5’ upstream region of a glutamine synthetase gene from Scots pine" pdf

... were used as controls 2.4 Gel retardation analysis A DNA fragment used for gel retardation analysis containing a sequence from the 5’-untranslated region of GS 1a was obtained by cleavage with ... infiltration of adult Arabidopsis thaliana plants, CR Acad Sci Paris, Life Sciences 816 (1993) 1194–1199 [6] Cánovas F.M., Cantón F.R., Gallardo F., Garc a- Gutiérrez A. , de Vicente A. , Accumulation ... in all compared organisms We have also analyzed the presence of putative elements in the 5’ region of the gene There is a canonical TATA box at –35 bp from the transcription start site and a putative...

Ngày tải lên: 08/08/2014, 14:20

6 328 0
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

... One approach to increase the duration of PNA binding to DNA is to conjugate it to a DNAalkylating reagent so that the PNA becomes covalently bound to its target sequence To this a DNA alkylating ... synthesis and characterization of a novel mitochondria-targeted alkylating reagent and show that it alkylates DNA in vitro and is taken up by mitochondria However, in spite of its substantial import, ... that the extent of alkylation was proportional to the amount of DNA present and was independent of the size of the DNA fragment (Fig 3A, lane 1) As mtDNA in vivo is negatively supercoiled it was...

Ngày tải lên: 20/02/2014, 11:20

10 639 0
Báo cáo hóa học: " Design and Characterization of a 5.2 GHz/2.4 GHz ΣΔ Fractional-N Frequency Synthesizer for Low-Phase Noise Performance" potx

Báo cáo hóa học: " Design and Characterization of a 5.2 GHz/2.4 GHz ΣΔ Fractional-N Frequency Synthesizer for Low-Phase Noise Performance" potx

... frequency of 40 MHz, a fairly standard charge pump and PFD configuration with gain Kphase of 750 A/ 2π, a multimodulus divider programmable between 64 and 127, and an LC-based VCO with a KVCO of approximately ... University of Central Florida under a Motorola Research Grant on SAW device package electrical characterization and oscillator design From 1991 to 1995, he was a Staff and Lead Oscillator Design ... modulator has been analyzed Analyzing an example synthesizer RFIC designed for multiband MIMO WLAN applications has validated the theory The analytical model achieved good agreements with measured...

Ngày tải lên: 22/06/2014, 22:20

11 417 0
Lab 6.2.9 Firmware Upgrade of a Catalyst 2900 Series Switch

Lab 6.2.9 Firmware Upgrade of a Catalyst 2900 Series Switch

... Switch#delete flash:vlan.dat Delete filename [vlan.dat]?[enter] Delete flash:vlan.dat? [confirm] [enter] If there was no VLAN file, this message is displayed %Error deleting flash:vlan.dat (No such ... hostname, access, and command mode passwords, as well as the management LAN settings These values are shown in the chart If problems occur while performing this configuration, refer to the Basic ... exit, and turn all the devices off Then remove and store the cables and adapter 3-4 CCNA 3: Switching Basics and Intermediate Routing v 3.0 - Lab 6.2.9 Copyright  2003, Cisco Systems, Inc Erasing...

Ngày tải lên: 16/10/2013, 21:15

4 337 0
Tài liệu LUYỆN ĐỌC TIẾNG ANH QUA TÁC PHẨM VĂN HỌC-THE ADVENTURES OF SHERLOCK HOMES -ARTHUR CONAN DOYLE 5-2 doc

Tài liệu LUYỆN ĐỌC TIẾNG ANH QUA TÁC PHẨM VĂN HỌC-THE ADVENTURES OF SHERLOCK HOMES -ARTHUR CONAN DOYLE 5-2 doc

... time that their sailing-ship reaches Savannah the mail-boat will have carried this letter, and the cable will have informed the police of Savannah that these three gentlemen are badly wanted here ... society was coincident with the disappearance of Openshaw from America with their papers It may well have been cause and effect It is no wonder that he and his family have some of the more implacable ... life and hope I shall certainly as you advise." "Do not lose an instant And, above all, take care of yourself in the meanwhile, for I not think that there can be a doubt that you are threatened...

Ngày tải lên: 24/12/2013, 20:15

18 363 0
Tài liệu w w w . a d c . c o m • + 1 - 9 5 2 - 9 3 8 - 8 0 8 0 • 1 - 8 0 0 - 3 6 6 - 3 8 9 1 127 Copper Connectivity Solutions – Specialty Products Copper Connectivity Solutions – Specialty Products pptx

Tài liệu w w w . a d c . c o m • + 1 - 9 5 2 - 9 3 8 - 8 0 8 0 • 1 - 8 0 0 - 3 6 6 - 3 8 9 1 127 Copper Connectivity Solutions – Specialty Products Copper Connectivity Solutions – Specialty Products pptx

... Hinged For examples of TIA/EIA color-coding, refer to the chart on page 170 Tech Tip Labeling templates are available in Microsoft‚ Word and Excel formats Please contact ADC Technical Assistance Center ... demarcation patch panels feature RJ48X or RJ48C wiring with a variety of rear termination options The T1 demarcation patch panels offer end users a familiar RJ interface by which the T1 signal ... Specialty Products Move base unit from bottom to top Flip and snap into place Features •  Appropriate for both data and voice application •  High-density and quick installation are the hallmarks...

Ngày tải lên: 24/01/2014, 11:20

16 368 0
Tài liệu Lab 3.2.5 Configuring Message-of-the-Day (MOTD) pptx

Tài liệu Lab 3.2.5 Configuring Message-of-the-Day (MOTD) pptx

... a description for the interface a The login banner should be a warning not to attempt login unless authorized In the following space, enter an appropriate warning banner The message can contain ... contain any printable character as well as spaces and carriage returns _ Step Enter the desired banner message a From the global configuration mode enter banner ... the type of router as well as how many interfaces the router has There is no way to effectively list all of the combinations of configurations for each router class What is provided are the identifiers...

Ngày tải lên: 24/01/2014, 19:20

4 469 0
Tài liệu Lab 3.2.5 Configuring Message of the Day pdf

Tài liệu Lab 3.2.5 Configuring Message of the Day pdf

... unless authorized In the following space, enter an appropriate warning banner The message can contain any printable character as well as spaces and carriage returns ... type of interface even though a specific router may contain one An example of this might be an ISDN BRI interface The string in parenthesis is the legal abbreviation that can be used in IOS command ... the change in the router prompt Step Display help for the banner motd command a Enter banner motd ? at the router prompt b What is the character called that is used to indicate the beginning and...

Ngày tải lên: 24/01/2014, 19:20

4 390 0
Tài liệu Lab 6.2.9 Firmware Upgrade of a Catalyst 2900 Series Switch doc

Tài liệu Lab 6.2.9 Firmware Upgrade of a Catalyst 2900 Series Switch doc

... Inc Erasing and Reloading the Switch For the majority of the labs in CCNA and CCNA it is necessary to start with an unconfigured switch Use of a switch with an existing configuration may produce ... startup configuration from NVRAM #delete nvram This command resets the switch with factory defaults All system parameters will revert to their default factory settings All static and dynamic addresses ... be: Erase of nvram: complete Check that VLAN information was deleted Verify that the VLAN configuration was deleted in Step using the show vlan command If previous VLAN configuration information...

Ngày tải lên: 24/01/2014, 19:20

5 335 0
Tài liệu Báo cáo khoa học: 2,5-diamino-6-ribitylamino-4(3H)-pyrimidinone 5¢-phosphate synthases of fungi and archaea docx

Tài liệu Báo cáo khoa học: 2,5-diamino-6-ribitylamino-4(3H)-pyrimidinone 5¢-phosphate synthases of fungi and archaea docx

... velocities of 3.8S for C glabrata and 3.5S for A aeolicus (Fig 3A and Fig S 2A) Sedimentation equilibrium analysis indicated relative masses of 57.8 kDa (C glabrata) and 50.6 kDa (A aeolicus) (Fig 3B and ... reductases of the riboflavin pathway have not been characterised so far On the basis of database searches, it has been assumed that putative plant pyrimidine reductase domains catalyse the equivalent ... deaminase contains equivalent of Zn2+ per subunit Thus, the early part of the riboflavin biosynthetic pathway in plants is similar to that of eubacteria, rather than that in fungi and archaea...

Ngày tải lên: 18/02/2014, 18:20

12 550 0
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢ For derivitization with TMR, a Gly-Gly-Cys sequence was introduced at the ... chain and hides a large amount of the hydrophobic surface area Surface area calculations for the pentamer give a total surface ˚ ˚ area of $ 81 000 A2 with 30% ($ 24 000 A2 ) as contact area Thus, ... 5¢-CTGCTGTCTACCTTTGGAGGTTGCTGATCCGAA TTCGAG-3¢ (forward) and 5¢-GCTCGAATTCGGATCAG CAACCTCCAAAGGTAGACAGCA-3¢ (reverse) BL21 cells were transformed with the pETM11 construct and grown until a D of 0.8...

Ngày tải lên: 19/02/2014, 06:20

10 648 0
Tài liệu Báo cáo khoa học: Cloning and characterization of CBL-CIPK signalling components from a legume (Pisum sativum) ppt

Tài liệu Báo cáo khoa học: Cloning and characterization of CBL-CIPK signalling components from a legume (Pisum sativum) ppt

... 5¢-GTATCAGCTTC(C ⁄ T)TCAAATGTC-3¢ 5¢-CCATCACAAGAAACTAGAGAAAC-3 5¢-TTAAGTACTATAAAT-ACACAGCCTA-3¢ 5¢-CGAGCTCACTGCCTCTCAAC-3¢ 5¢-ACTCGTAGC-ACAGAGACAGAG-3¢ 5¢-ATGGCAGTAGTAGCAG-CTCC-3¢ 5¢-TCAGGTGTCT-AAGTTCAGAGATTC-3¢ ... Remarks 10 11 12 13 5¢-GG (A ⁄ T)CA (A ⁄ C)GG (A ⁄ T)AC (A ⁄ C)TT(C ⁄ T)GC(C ⁄ G ⁄ T)AAGGT-3¢ 5¢-ACAAA (A ⁄ C )A( A ⁄ G) (A ⁄ G ⁄ T )A( C ⁄ T) (A ⁄ C ⁄ G)ACACCACAAGACC)3¢ 5¢-CTTAT(C ⁄ G)AACAAGGAA (A ⁄ C)AATTTC-3¢ ... 5¢-TCAGGTGTCT-AAGTTCAGAGATTC-3¢ 5¢-ATGTTGCAGTGCTTAGAGGGA-3¢ 5¢-TTAAGTATCATCTACTTGTGAATG-3¢ 5¢-CCTCCGGAATTCATGGCAGTAGTAGCAGCTCC-3¢ 14 5¢-CCGCCGCTCGAGTCAGGTGTCTAAGTTCAGAGATTC-3¢ 15 5¢-GCCATGCCATGGCAATGTTGCAGTGCTTAGAGGGA-3¢...

Ngày tải lên: 19/02/2014, 07:20

19 707 0
w