figure51 components of a disk

List the components of a radio system

List the components of a radio system

... – Advantages • Can carry up to three times the amount of data as TDMA • Transmissions are much harder to eavesdrop on • A would-be eavesdropper must also know the exact chip in which the transmission ... the signal • Attenuation – A loss of signal strength • Multipath distortion – As a radio signal is transmitted, the electromagnetic waves spread out 24 Signal Strength (continued) 25 Radio Frequency ... • List the components of a radio system • Describe how different factors affect the design of a radio system • Explain the radio frequency spectrum Components of a Radio System • Components include:...

Ngày tải lên: 13/09/2012, 10:52

30 922 0
Novel design of a disk-shaped compacted micro-structured air-breathing PEM fuel cell

Novel design of a disk-shaped compacted micro-structured air-breathing PEM fuel cell

... distribution patterns of activation overpotentials are similar, with higher values at the catalyst layer near the air inlet area It can be seen that the activation overpotential profile correlates with ... Mechanical behaviour of PEM fuel cell catalyst layers during regular cell operation International Journal of Energy and Environment, 2010; 1(6), 927-936 [16] Maher A. R Sadiq Al-Baghdadi A CFD analysis ... performance and design of air-breathing PEM fuel cells Litster and Djilali [1] developed a single-phase one-dimensional semi-analytical model of the membrane electrode assembly (MEA) of planar air-breathing...

Ngày tải lên: 05/09/2013, 14:58

20 521 0
Lab 5.1.11 Building a Peer-to-Peer Network

Lab 5.1.11 Building a Peer-to-Peer Network

... are directly connected The default Gateway is only required on local area networks that are connected to a router Computer IP Address Subnet mask Default Gateway PC – A 192.168.1.1 255.255.255.0 ... they can be restored at the end of the lab These include IP address, subnet mask, default gateway, and DNS servers If the workstation is a DHCP client, it is not necessary to record this information ... the two PCs a Set the IP address information for each PC according to the information in the table b Note that the default gateway IP address is not required, since these computers are directly...

Ngày tải lên: 27/10/2013, 07:15

4 552 0
Lab 5.1.12 Building a Peer-to-Peer Network

Lab 5.1.12 Building a Peer-to-Peer Network

... are directly connected The default gateway is only required on local area networks that are connected to a router Computer IP Address Subnet mask Default Gateway PC – A 192.168.1.1 255.255.255.0 ... they can be restored at the end of the lab These include IP address, subnet mask, default gateway, and DNS servers If the workstation is a DHCP client, it is not necessary to record this information ... the two PCs a Set the IP address information for each PC according to the information in the table b Note that the default gateway IP address is not required, since these computers are directly...

Ngày tải lên: 27/10/2013, 07:15

4 476 0
Lab 5.1.13a Building a Hub-based Network

Lab 5.1.13a Building a Hub-based Network

... PCs and the hub will be accomplished using a Category or 5e straight-through patch cable Locate two cables that are long enough to reach from each PC to the hub Attach one end to the NIC and ... these computers are directly connected The default gateway is only required on local area networks that are connected to a router Computer IP Address Subnet mask Default Gateway PC – A 192.168.1.1 ... settings, so that they can be restored at the end of the lab These include IP address, subnet mask, default gateway, and DNS servers If the workstation is a DHCP client, it is not necessary to record...

Ngày tải lên: 04/11/2013, 16:15

4 353 0
Lab 5.1.13b Building a Switch-based Network

Lab 5.1.13b Building a Switch-based Network

... patch cable Locate two cables that are long enough to reach from each PC to the switch Attach one end to the NIC and the other end to a port on the switch Be sure to examine the cable ends carefully ... are directly connected The default gateway is only required on local area networks that are connected to a router Computer IP Address Subnet mask Default Gateway PC – A 192.168.1.1 255.255.255.0 ... the two PCs a Set the IP address information for each PC according to the information in the table b Note that the default gateway IP address is not required, since these computers are directly...

Ngày tải lên: 05/11/2013, 12:15

4 533 0
Tài liệu Activity 5.1: Risks of Skipping Logical Design docx

Tài liệu Activity 5.1: Risks of Skipping Logical Design docx

... benefits that logical design brings to the design process As a class, discuss the possible risks involved in not completing a logical design The instructor will write your answers on a flip chart ... 28 Activity 5.1: Risks of Skipping Logical Design Exercise 1: Identifying Potential Risks of Not Doing Logical Design ! Identify potential risks of not doing logical design Consider...

Ngày tải lên: 10/12/2013, 16:16

2 334 0
Tài liệu Lab 5.1.13b Building a Switch-based Network pptx

Tài liệu Lab 5.1.13b Building a Switch-based Network pptx

... patch cable Locate two cables that are long enough to reach from each PC to the switch Attach one end to the NIC and the other end to a port on the switch Be sure to examine the cable ends carefully ... are directly connected The default Gateway is only required on local area networks that are connected to a router Computer IP Address Subnet mask Default Gateway PC – A 192.168.1.1 255.255.255.0 ... the two PCs a Set the IP address information for each PC according to the information in the table b Note that the default gateway IP address is not required, since these computers are directly...

Ngày tải lên: 11/12/2013, 14:15

4 574 0
Tài liệu Báo cáo khoa học: Mutational analysis of plasminogen activator inhibitor-1 Interactions of a-helix F and its neighbouring structural elements regulates the activity and the rate of latency transition pdf

Tài liệu Báo cáo khoa học: Mutational analysis of plasminogen activator inhibitor-1 Interactions of a-helix F and its neighbouring structural elements regulates the activity and the rate of latency transition pdf

... T9 6A F10 0A V12 6A F12 8A S12 9A E13 0A V13 1A E13 2A R13 3A R13 5A F13 6A I13 7A I13 8A N13 9A D14 0A W14 1A V14 2A K14 3A T14 4A H14 5A T14 6A K14 7A M14 9A N15 2A E28 3A E28 5A K32 5A K32 7A PAI-1stab PAI-1stab(E28 5A) ... SDS/PAGE analysis After 24 h, the fraction of molecules behaving as a substrate for uPA decreased approximately twofold for PAI-1(V12 6A) , PAI-1(F10 0A) , PAI-1(F12 8A) and PAI-1(W14 1A) with a concomitant ... rate of latency transition expressed as the functional half-life, t½ The averages and standard deviations for at least three independent measurements are given for each variant PAI-1 variant Activity...

Ngày tải lên: 20/02/2014, 11:20

9 606 0
Báo cáo khoa học: Identification of preferred substrate sequences for transglutaminase 1 – development of a novel peptide that can efficiently detect cross-linking enzyme activity in the skin pot

Báo cáo khoa học: Identification of preferred substrate sequences for transglutaminase 1 – development of a novel peptide that can efficiently detect cross-linking enzyme activity in the skin pot

... – 2A – 1A QN + 1A + 2A + 3A + 4A + 5A + 6A + 7A + 8A + 9A Fig Assessment of the contribution of each amino acid residue of K5 to substrate recognition Alanine substitution mutants of K5 were produced as ... M, Yamashita F, Ishida-Yamamoto A, Yamada K, Kinoshita C, Fushiki S, Ueda E, Morishima Y, Tabata K, Yasuno H et al (1998) Defective stratum corneum and early neonatal death in mice lacking the ... Furutani Y, Kato A, Notoya M, Ghoneim MA & Hirose S (2001) A simple assay and histochemical localization of transglutaminase activity using a derivative of green fluorescent protein as substrate...

Ngày tải lên: 23/03/2014, 06:20

11 449 1
Báo cáo khoa học: Characterization of the 5¢ untranslated region of a and b isoforms of the human thromboxane A2 receptor (TP) Differential promoter utilization by the TP isoforms doc

Báo cáo khoa học: Characterization of the 5¢ untranslated region of a and b isoforms of the human thromboxane A2 receptor (TP) Differential promoter utilization by the TP isoforms doc

... rates [29], stimulation of apoptosis of immature thymocytes [30] TXA2 has been implicated as a mediator of a number of vascular disorders including thrombosis, unstable angina, myocardial infarction, ... Kinase reporter vectors and Dual LuciferaseÒ Reporter Assay System were obtained from Promega Corporation, Madison, WI, USA Taq DNA polymerase, T4 DNA ligase and calf intestinal alkaline phosphatase ... substantial variations in the relative levels of expression of TPa and TPb mRNAs in a variety of human tissues; whereas TPa mRNA levels remains constant between cell types, the levels of TPb vary...

Ngày tải lên: 31/03/2014, 09:20

16 321 0
báo cáo hóa học:" Representation to the Accident and Emergency department within 1-year of a fractured neck of femur" ppt

báo cáo hóa học:" Representation to the Accident and Emergency department within 1-year of a fractured neck of femur" ppt

... falls, 57 fractures, head injures) required acute care because of a fall A fall may not have been the offending mechanism in all cases—some patients may have sustained pathological fractures or ... for Trauma (BOAST), 2007 www.boa.ac.uk (last accessed 09/02/2011) National Hip Fracture Database (NHFD) The National Hip Fracture Database National Report 2010 www.nhfd.co.uk (last accessed 09/02/2011) ... Secondary prevention of falls has emerged as a tenet of the multidisciplinary management of hip fractures With a multitude of factors implicated, including symptomatic cardiovascular pathology...

Ngày tải lên: 20/06/2014, 07:20

16 395 0
Báo cáo hóa học: " Improvement on thermal performance of a diskshaped miniature heat pipe with nanofluid" docx

Báo cáo hóa học: " Improvement on thermal performance of a diskshaped miniature heat pipe with nanofluid" docx

... and the average diameter of a carbon nanoparticle was approximately 68 nm For convenience, the mixture of multiwall carbon nanotubes and carbon nanoballs in the base fluid was still called carbon ... Hommer MB, Natan MJ: Preparation and characterization of Au colloid monolayers Anal Chem 1995, 67:735-743 13 Cengel YA: Heat Transfer: A Practical Approach McGraw Hill: Singapore; 2003 14 Tsai CY, ... viscosity of the nanofluid with carbon nanoparticles is about 12% higher than that of the DI water The volume fraction of carbon nanoparticles in the nanofluid is about 9.7% As compared with the nanofluid...

Ngày tải lên: 20/06/2014, 22:20

7 387 0
Báo cáo khoa học: "Structural and functional characterization of the 5’ upstream region of a glutamine synthetase gene from Scots pine" pdf

Báo cáo khoa học: "Structural and functional characterization of the 5’ upstream region of a glutamine synthetase gene from Scots pine" pdf

... were used as controls 2.4 Gel retardation analysis A DNA fragment used for gel retardation analysis containing a sequence from the 5’-untranslated region of GS 1a was obtained by cleavage with ... infiltration of adult Arabidopsis thaliana plants, CR Acad Sci Paris, Life Sciences 816 (1993) 1194–1199 [6] Cánovas F.M., Cantón F.R., Gallardo F., Garc a- Gutiérrez A. , de Vicente A. , Accumulation ... in all compared organisms We have also analyzed the presence of putative elements in the 5’ region of the gene There is a canonical TATA box at –35 bp from the transcription start site and a putative...

Ngày tải lên: 08/08/2014, 14:20

6 328 0
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

... One approach to increase the duration of PNA binding to DNA is to conjugate it to a DNAalkylating reagent so that the PNA becomes covalently bound to its target sequence To this a DNA alkylating ... synthesis and characterization of a novel mitochondria-targeted alkylating reagent and show that it alkylates DNA in vitro and is taken up by mitochondria However, in spite of its substantial import, ... that the extent of alkylation was proportional to the amount of DNA present and was independent of the size of the DNA fragment (Fig 3A, lane 1) As mtDNA in vivo is negatively supercoiled it was...

Ngày tải lên: 20/02/2014, 11:20

10 639 0
Báo cáo khoa học: S-nitrosylated proteins of a medicinal CAM plant Kalanchoe pinnata – ribulose-1,5-bisphosphate carboxylase⁄oxygenase activity targeted for inhibition pot

Báo cáo khoa học: S-nitrosylated proteins of a medicinal CAM plant Kalanchoe pinnata – ribulose-1,5-bisphosphate carboxylase⁄oxygenase activity targeted for inhibition pot

... Kalanchoe, Arabidopsis and animals Hypothetical protein, *not relevant in animals J K Abat et al S-nitrosylated proteins of Kalanchoe pinnata, a CAM plant 2865 S-nitrosylated proteins of Kalanchoe ... both Arabidopsis, a C3 plant [9], and K pinnata, a CAM plant (this study) Carbonic anhydrase is present in animals, plants, eubacteria and viruses [25] S-glutathiolation of mammalian carbonic anhydrase ... carboxylase activity A Initial activity Total activity 140 C on % Rubisco carboxylase activity A J K Abat et al Fig Rubisco activity is inhibited by GSNO (A) Leaf extracts of Kalanchoe pinnata...

Ngày tải lên: 16/03/2014, 06:20

11 414 0
Giáo án tiếng anh lớp 7: Test 1 Grade: 10 Time limit: 45 minutes (0.5 point for each of a right pot

Giáo án tiếng anh lớp 7: Test 1 Grade: 10 Time limit: 45 minutes (0.5 point for each of a right pot

... eyes These social “rules” are the same for two men, two women, a man and a woman, or an adult and a child In the US and Canada, when you are having a conversation with someone,…… A not look directly ... on the board or read the correct answers passage again several times - Compare with - Get students toread the the passage again carefully other classmates - Call some students to - Compare with ... A uneasy B main C unreasonable D mean A cities B distances C states D C with D countries A on B from in A written D spoken B spelling C dictation II Speaking: Match each of the sentences in A...

Ngày tải lên: 27/07/2014, 19:21

14 787 0
Báo cáo sinh học: "Mapping of a milk production quantitative trait locus to a 1.056 Mb region on bovine chromosome 5 in the Fleckvieh dual purpose cattle breed" pps

Báo cáo sinh học: "Mapping of a milk production quantitative trait locus to a 1.056 Mb region on bovine chromosome 5 in the Fleckvieh dual purpose cattle breed" pps

... DD 2A AAGAGGAAAGCCCGGAAGAAGGGAG G A •••••••••••GG•••••AC• G••G•••••••AAAA••AC••AAC• G A ••••••••• A A G••AC• GGA• A G•• A AAG A •••AC• G•• A G•• A •••G A •••AC• G 36 Figure Familial relationships ... TGGTTTAGCAGAGAGCACATG GCTCCTAGCCCTGCACAC Set0 DIK4843 107.02 107077504-107078179 CATGCAAGCTTTCAAGAATGA TGCAGAGATAAGCCGAGGAC Set4 DIK1135 108.22 10181410-10182069 GTCTGCCATCTAGCCAAAAA GTTTTTCAGTGGGCATTTGG ... CAACAAACTGTGCGTTGTGA ACTCAGCAGTTGCCCTCAGT Set3 BM2830 116.91 115262054-115262075 AATGGGCGTATAAACACAGATG TGAGTCCTGTCACCATCAGC Set0 10 BM49 118.06 116205343-116205972 CACCATATTTGCCAGGATCA GCGGGATCTCACTAAACCAG...

Ngày tải lên: 14/08/2014, 13:21

11 357 0
w