fiber complex carbohydrates and health outcomes a need for fiber equivalents
Báo cáo y học: "Figuring out what works: a need for more and better studies on the relationship between ICU organization and outcomes" potx
... training and organization of intensivists With a virtual absence of information relating ICU training with ICU outcomes, many questions remain unanswered Is there an optimal duration of training? ... doi:10.1186/cc8843 Cite this article as: Garland A: Figuring out what works: a need for more and better studies on the relationship between ICU organization and outcomes Critical Care 2010, 14:108 ... Zygun DA, Stelfox HT, Peets AD: Intensivists’ base specialty of training is associated with variations in mortality and practice patterns Crit Care 2010, 13:R209 Center for the Evaluative Clinical...
- 2
- 271
- 0
Tài liệu WOMEN AND HEALTH CARE: A NATIONAL PROFILE ppt
... economic factors, age, and health status and health needs Many women experience a range of barriers to care that are logistical and economic in nature These include lack of coverage or coverage that ... Survey, Kaiser Family Foundation 12 Women and Health Care: A National Profile CHAPTER 3: WOMEN AND HEALTH INSURANCE COVERAGE Although several factors determine whether and how women use health care ... 8a Changes in Affordability as a Barrier to Care, by Insurance Status, 2001 and 2004, Women Ages 18 to 64 46 Exhibit 8b Changes in Mammography and Pap Smear Rates, 2001 and 2004 46 CHAPTER CHAPTER...
- 62
- 452
- 0
Surviving Health Care A Manual for Patients and Their Families potx
... of health information: a Federal, state, and county governments b Medical and osteopathic schools c The American Medical Association and state and county medical societies d National, state, and ... Dutch Debate about Euthanasia, and Ward Ethics: A Case Book for Doctors-in-Training, along with several books on aesthetics and design Surviving Health Care A Manual for Patients and Their Families ... diseases Know what health maintenance and preventive health Becoming an Active Member of Your Health Care Team 23 care interventions are appropriate for your age, gender, and diseases, and make sure...
- 339
- 7,952
- 0
Collaboration and Action to Improve Child Health Systems: A Toolkit for State Leaders docx
... Medicaid managed care arrangements depend on contracts appropriate to child health needs and systems Medicaid Managed Care and Child Managed Care Arrangements and Contracts Health To a great extent, ... initiative to devise child health quality measures Health reform legislation — the Patient Protection and Affordable Care Act (PPACA) and the Health Care and Education Affordability Reconcilia ... of a child’s health care operate as a team; that families are critical members of that team; and that all team members understand the importance of quality, coordinated medical, mental and oral...
- 52
- 417
- 0
Sibship Size and Health Outcomes in Later Life among the Mexican Elderly pptx
... such as allergies and asthma (Karmaus et al 2001, Karmaus and Botezan 2002), certain cancers (Westergaard et al 1997, Chang et al 2004) and periodontal disease (Mucchi et al 2004) For instance, ... Summary statistics of key variables used for analysis are presented in the appendix table Outcome variables are years of education (in years) and a battery of binary variables of health measures ... number of siblings and educational attainment in the data Years of schooling are regressed on age, age squared, dummy variables for parental education and childhood characteristics, and the number...
- 35
- 478
- 0
Socioeconomic position and health in a population of Brazilian elderly: the Bambuí Health and Aging Study (BHAS) pdf
... (puntuación en el Cuestionario General de Salud, autovaloración del estado de salud y de la agudeza visual, grado de dificultad para caminar 300 metros, incapacidad para realizar las actividades ... in health Br Med J 1997;314:1545–1549 31 Atalah E, Benavides X, Avila L, Barahona S, Cárdenas R Características alimentarias de adultos mayores de comunas pobres de la Región Metropolitana Rev ... pesar de la abundante bibliograf a científica existente sobre los determinantes sociales de la salud, a n se debate hasta qué punto esa relación se mantiene durante la edad avanzada El objetivo...
- 8
- 735
- 0
Inappropriate Medication Use and Health Outcomes in the Elderly docx
... significant racial disparity in health status, in that African Americans had poorer health status than their white counterparts Previous literature has suggested that African Americans have higher rates ... health status for Models D and F; and health condition variables for Models E and F Ã Po.01; wPo.001 JAGS NOVEMBER 2004–VOL 52, NO 11 INAPPROPRIATE MEDICATION USE AND HEALTH OUTCOMES 1937 Table ... population studied was people aged 65 and older Analytical Approaches Outcomes Variable The primary outcomes variable was self-perceived health status In MEPS, respondents were asked to rate their...
- 6
- 613
- 0
Agriculture and Cancer: a need for action docx
... that policies and programs are in place to guarantee the safe and equitable working conditions necessary to prevent cancer and other diseases in workers Both EPA and the Occupational Safety and ... Starr County, Texas, Journal of Agricultural Safety and Health 2005; 11(1): 51–60 31 Arcury TA, Quandt SA, Austin CK, et al Implementation of EPA’s Worker Protection Standard Training for Agricultural ... exposure disparities among seasonal farm workers and their families A serious cancer prevention agenda must ensure that policies and programs are in place to guarantee the safe and equitable working...
- 12
- 381
- 0
Social capital and Health status: a protective impact among elderly or inactive but not among active ? doc
... self-assessed health status and to have a regular social participation on whole population Finding indicates that after instrumentation, social capital (that is to say having a regular social participation) ... health to explain health disparities Social capital is actually considered as a potential explanatory factor of an individual’s health status since social interaction, trust and reciprocity facilitate ... self-assessed health status among the whole population and subpopulations in order to test a different association of social participation and health status according to occupation and age The estimation...
- 27
- 465
- 0
Environment and health risks: a review of the influence and effects of social inequalities pptx
... shaping a common health- in-all policies approach (HIAP) Clearly, national health and welfare systems need to address the increasing problem of health inequalities, and as environmental inequalities ... page 32 Authors Population /country Poznan and Wroclaw (Poland) a Health variables Air pollution variablesa Geographical level and SES variables Methods to evaluate effect modification Main results ... BS, NO2 and SO2 (day of death or preceding day) Geographical level and SES variables Laurent et al Laurent et al Wojtyniak et al Beta-agonist sales for asthma At a French census block scale (2000...
- 268
- 555
- 0
Báo cáo y học: "A need for a ‘whole-istic functional genomics’ approach in complex human diseases: arthritis" pptx
... complex interaction and interplay The synovium can be classified and analyzed as normal and hypertrophic, and the latter can be subdivided as cartilage invasive and noninvasive in different forms ... using a singular rather than a plural noun, implying that it might be a single process or a type of process The avascular, alymphatic and aneural human OA-affected articular cartilage harboring ... (synovium, bone and cartilage) and systems (mobile joints in animal models such as rodents and Zebra fish), as well as the interactions that change in the disease state (clinical material and diagnosis)...
- 4
- 322
- 0
Báo cáo y học: " Acute bronchodilator responsiveness and health outcomes in COPD patients in the UPLIFT trial" pot
... after randomization and requested 30 days after the last dose of study medication Information on exacerbations, exacerbations leading to hospitalization, and adverse events was collected at all ... after Day 30 Change in FEV1 and FVC data are based on repeated-measures ANOVA model, adjusted for baseline Rates of decline in FEV1 data are based on randomeffects model *p ≤ 0.001 versus placebo ... Responder p-value and hazard ratio based on Cox-regression for analysis of time to first exacerbation p-value and rate ratio based on Poisson-regression with adjustment for overdispersion for analysis...
- 11
- 291
- 0
Farmland loss and livelihood outcomes A microeconometric analysis of household surveys in Vietnam
... (VietNamNet/TN, 2009) Increasing urban population and rapid economic growth, particularly in urban areas of large cities, have resulted in a great demand for urban land Taking Hanoi as an example, ... fixed and slowly changing factors, including the household‟s natural capital, human capital, and location variables In addition, other factors, in this case farmland loss and past livelihood strategies ... informal wage work soon after losing land On the one hand, this is indicative of high availability of informal wage work in Hanoi‟s urban and peri-urban areas On the other hand, for a number of land-losing...
- 27
- 372
- 0
Birth weight ethnic differences and health outcomes in childhood
... content and quality of the databases, and this may vary between registries and for different outcomes All relevant information may not be available and the standardization may differ within and between ... (95%CI) adjusted for gestational and maternal age as continuous variables, and gender, year of birth and maternal education as a categorical variables Adjustment substituting birth order instead of ... first year of life HR(95%CI) unadjusted HR(95%CI) adjusted for gestational and maternal age as continuous variables and gender, year of birth and maternal education as categorical variable Adjustment...
- 156
- 390
- 0
Pharmacoeconomics and health outcomes research for hepatitis b virus infection in singapore
... Pharmacoeconomics and Outcomes Research Healthcare reform and technological advances are creating changes in how health care interventions are evaluated Increasingly, patients and other healthcare providers and ... description and analysis of the costs and consequences of pharmaceuticals and pharmaceuticals services, and its impact on individuals, health care systems, and society On the other hand, outcomes research ... significant personal and social burden on those infected, as well as to the health care system The actual and potential costs of CHB treatment and care are substantial (Yang et al., 2001) For example, the...
- 246
- 193
- 1
Tài liệu Women’s health & safety: A guide for UNISON safety representatives pptx
... email the Health and Safety Unit at the above address The TUC has produced health and safety information aimed at women, and also publishes a comprehensive guide to health and safety called “Hazards ... representative, and may also help to attract new UNISON members UNISON has produced a range of guidance and information sheets which safety representatives can use to tackle many of the health and safety ... Regulations employers must: s Avoid manual handling operations as far as is reasonably practicable s Assess any hazardous manual handling operations that cannot be avoided s Remove or reduce the...
- 14
- 571
- 0
Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf
... Liljas A, Kristensen O, Laurberg M, Al-Karadaghi S, Gudkov A, Martemyanov K, Hughes D & Nagaev I (2000) The states, conformational dynamics, and fusidic acid-resistant mutants of elongation factor ... Helgstrand M, Mandava CS, Mulder FA, Liljas A, Sanyal S & Akke M (2007) The ribosomal stalk binds to translation factors IF2, EF-Tu, EF-G and RF3 via a conserved region of the L12 C-terminal domain ... interactions Mutation to introduce a side chain would induce a steric clash and conformational change, and affect the nearby ribosome contact Mutation may disturb ribosome interactions Mutation may...
- 15
- 474
- 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT GACCGCCTCCC-3¢); for Golf (5¢-GGTACCGCTGCAA TGGGGTGTTTGGGCAAC-3¢) and (5¢-GCGGCCGCCT CAGATCACAAGAGTTCGTACTGC-3¢); ... vector was obtained from pJH2-SSTR2 by homologous recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢)...
- 14
- 473
- 0
E-Commerce and Consumer Goods A Strategy for Omnichannel Success doc
... marketing, and specializes in strategy and capability development for consumer brand marketers, marketing services firms, and media companies Arun Rajagopalan is a principal with Booz & Company based ... Offices Asia Beijing Delhi Hong Kong Mumbai Seoul Shanghai Taipei Tokyo Australia, New Zealand & Southeast Asia Bangkok Brisbane Canberra Jakarta Kuala Lumpur Melbourne Sydney Europe Amsterdam Berlin ... purchases, and descriptive materials and images that make it easier for consumers to find and learn about the manufacturer’s products on the retailer’s website; capturing, and mining online sales...
- 16
- 266
- 0
Báo cáo khoa học: Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation potx
... Schizophrenia and Depression (JAB), the National Institute of Mental Health (ACN and RWG), the Department of Defense (JAB and AAF), the Department of Veterans A airs (RWG), and the Ella McFadden Charitable ... PAGE (15% acrylamide) and PhosphorImager analysis To calculate reaction stoichiometries, radiolabeled reaction products and radioactive standards were quantitated using IMAGEQUANT software (Amersham ... 20 amino acids of mAK-L (MAAADEPKPKKLKVEAPQA) are replaced by four residues (MTST) in mAK-S This results in a length of 361 and 345 amino acids for mAK-L and mAK-S, respectively Mouse and human...
- 9
- 497
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25