features of a functional programming language

Ngày tải lên: 23/10/2014, 15:20

... this class may expand into the class of all nouns. Once word classes are found, lexical features can be extracted by assuming that there is a feature of the language which accounts for each ... there is a great deal of information encoded in such a model about the distributional behavior of words with respect to a very local context, namely the context of imme- diately adjacent words. ... of times b follows a in the corpus. 2. Divide this value by the number of times a occurs in the corpus. Such a model is clearly insufficient for expressing the grammar of a natural language. ...

Ngày tải lên: 17/03/2014, 08:20

... shorthand syntax for declaring properties that map directly onto a field and have trivial get and set methods. A field is created automatically for such a property, as well as the default get and ... Classes (MFC), you know about the message map. Events in C++/CLI are a language feature that builds into the language the idea of a mapping between events and functions that handle those events. ... delegate declaration. BeginInvoke has the same parameters as the usual Invoke function, plus two additional parameters: the first is an AsyncCallback class and the second is the delegate. EndInvoke...

Ngày tải lên: 05/10/2013, 07:20

... antibodies were as follows: anti-porin from Calbiochem, anti-HA from Covance BabCo, anti-mouse and anti-rabbit secondary antibodies from Bio-Rad Laboratories and Amersham Pharmacia Biotech, respectively. Antibodies ... fraction is designated as the mitochondrial fraction. Immunochemical assays and antibodies Mitochondrial protein samples (between 50 and 100 lg) were separated by SDS/PAGE and BN/PAGE and trans- ferred ... s uspension was used per assay. Oxygen consumption was measured polaro- graphically with a Clark oxyge n electrode in metabolic chamber with a water jacket maintained at 37 °C(Hansa- tech, Norfolk,...

Ngày tải lên: 19/02/2014, 16:20

... mediated by the forward primer xb101+ (5Â-gccgcccatatgcaccaccaccaccaccacagcaccagtca gaactct), the reverse primer xa100 (5Â-gtggtgaattcagc cagtgtgcccttg), and pNIall2 as a template. To facilitate purification ... xdhC gene (PA1522) was amplified from genomic DNA of P. aeruginosa PAO1-LAC, via stepdown PCR, using forward xc1+ (ctgaacaagcttgatcgggaggatgacgag) and reverse xc1e– (gcggggctcgagtcaggattcgtgggcgc) ... xdhAB, xprA and ssuACB are available in GenBank (accession number AY082333). Results Gene localization and sequence The observation of a naturally occurring plasmid as part of the C. acidovorans genomic...

Ngày tải lên: 16/03/2014, 23:20

... for a bank ATM. Averaging over participants and correlating across layouts they obtained a correlation of 0.6 between ratings of usability and beauty. This finding is potentially important ... participant in an experiments is asked to rate a design they imagine themselves in a particular situation and make some evaluation of Apparent Product Character and then what the Consequences of ... product can affect its apparent usability 11 Features with pragmatic and hedonic character. It is however assumed that several elements of Apparent Product Character will interact to determine...

Ngày tải lên: 23/03/2014, 13:20

... this article as: Bae and Park: A fixed-point approach to the stability of a functional equation on quadratic forms. Journal of Inequalities and Applications 2011 2011:82. Bae and Park Journal of ... Găvruta, P: A generalization of the Hyers-Ulam-Rassias stability of approximately additive mappings. J Math Anal Appl. 184, 431–436 (1994). doi:10.1006/jmaa.1994.1211 6. Jung, S-M: Hyers-Ulam-Rassias ... multidimensional functional equation having quadratic forms as solutions. J Inequal Appl 2007 (2007). Article ID 24716 11. Rassias, TM: On the stability of linear mappings in Banach spaces. Proc Amer Math...

Ngày tải lên: 20/06/2014, 22:20

... Hyers-Ulam stability of a functional equation in various normed spaces Hassan Azadi Kenary 1 , Sun Young Jang 2 and Choonkil Park 3* * Correspondence: baak@hanyang. ac.kr 3 Department of Mathematics, Research ... Nonlinear L -random stability of an ACQ functional equation. J Inequal Appl 2011 (2011). Article ID 194394 13. Kenary, HA: On the Hyers-Ulam-Rassias stability of a functional equation in non-Archimedean ... normed spaces. Rend Del Circolo Math Di Palermo. (to appear) 9. Kenary, HA, Shafaat, Kh, Shafei, M, Takbiri, G: Hyers-Ulam-Rassias stability of the Appollonius quadratic mapping in RN- spaces. J...

Ngày tải lên: 20/06/2014, 22:20

... Nonlinear Differential Equations and Their Applications, Birkh ă auser, Boston, Mass, USA, 1998. 8 S M. Jung, Hyers-Ulam-Rassias Stability of Functional Equations in Mathematical Analysis, Hadronic Press, ... the stability of an equation of the square spiral,” Banach Journal of Mathematical Analysis, vol. 1, no. 2, pp. 148–153, 2007. 14 S M. Jung and J. M. Rassias, “Stability of general Newton functional ... of Ulam,” Acta Applicandae Mathematicae, vol. 62, no. 1, pp. 23–130, 2000. 12 S M. Jung and P. K. Sahoo, “Stability of a functional equation for square root spirals,” Applied Mathe- matics...

Ngày tải lên: 22/06/2014, 11:20

Ngày tải lên: 22/06/2014, 22:20

Ngày tải lên: 13/08/2014, 09:21

Ngày tải lên: 23/10/2014, 14:23

Ngày tải lên: 23/10/2014, 20:10

Ngày tải lên: 24/10/2014, 22:24

... such a class is not quite the same as an interface. An interface class has no fields and no method implemen- tations; an abstract base class may have these. Also, multiple interface classes may ... give you a general idea of what C++/CLI is all about by providing a brief look at most of the new language features in the context of an extended example, saving the details for later chapters. ... this example. The previous sections demonstrated the declaration and use of managed aggregate types, including ref classes, value classes, managed arrays, enum classes, and interface classes....

Ngày tải lên: 05/10/2013, 08:20

... now available. Eiffel also has a standard library. The standard library is more changeable than the base language, but is also under the control of NICE. Thus Eiffel has attained a great deal of ... not relate to its stability and maturity. Java is the youngest language, but Java appears to have a well thought out and stable language base, also having a comprehensive set of OO libraries. ... that other languages target the Java virtual machine, and that it becomes a universal machine code. Such a marriage might not be as easy as it appears, if the object models of different languages...

Ngày tải lên: 08/03/2014, 23:20

... we have sucessfully added gram- matical features to a WSME language model us- ing a SCFG to extract the grammatical informa- tion. We have shown that the the use of gram- matical features in a ... param- eters of a WSME language model . In that work, a comparison was made between the per- formance of WSME models trained using MCMC and WSME models trained using PS. Features of n-grams and ... . Because we have total control over the distribition , is easy to sample from it in the traditional way. 3 The grammatical features The main goal of this paper is the incorporation of gramatical...

Ngày tải lên: 23/03/2014, 19:20

... 4676 Admiralty Way Marina del Rey, California 90292 USA Summary Programming a computer to operate to a significant degree as an author is a challenging research task. The creation of fluent ... it is appropriate to make each particular grammatical choice of a language? " It differs from other semantic approaches in that 1. its scope is confined to grammar, rather than addressing ... Knowledge Base. The treatment of the lexicon separates a variety of lexical phenomena in separate, controlled ways: denotational appropriateness, syntactic features, and nonsyntactic .~onde=~otational...

Ngày tải lên: 24/03/2014, 05:21

Ngày tải lên: 24/10/2014, 21:49

Ngày tải lên: 02/03/2015, 14:20