... 31 Table Advantages and disadvantages of major proteomic platforms 38 Table Experimental design of vehicle and drug-treatments of HET mice 50 Table Gel setup for 2D- DIGE experiments ... protein-chipbased arrays There are advantages and disadvantages to both platforms and they are listed in Table Due to the numerous facets of protein characteristics that make up a proteome, complementary ... Each label also exploits the NHS ester and an isobaric tag of 145 Da that consists of a balance group (carbonyl group) and a reporter group (based on N-methylpiperazine) via the formation of an...
Ngày tải lên: 12/09/2015, 11:08
... experimental set-up, dietary triglyceride absorption, measured as a post-gavage increase in plasma triglyceride levels, becomes apparent at approximately h following the oral administration of ... E A Karavia et al the molecular mechanisms of metabolic syndrome at the University of Patras We would like to thank mathematician Mr Eleftherios Kypreos for his advice on the statistical analysis ... containing a targeted replacement of the mouse apoE gene for the human apoE3 gene), we have shown that, in addition to its role in the maintenance of plasma lipid homeostasis, apoE plays a central...
Ngày tải lên: 05/03/2014, 23:20
Báo cáo hóa học: " Exploring the molecular mechanisms underlying the potentiation of exogenous growth hormone on alcohol-induced fatty liver diseases in mice" ppt
... activated hepatic AMPK and PPARa in AFLD mice (Figure 5) GH1-mediated activation of AMPK was accompanied by increased phosphorylation of acetyl-CoA carboxylase (ACC), a downstream target of AMPK, ... antiphosphorylated-AMP-activated protein kinase (AMPK) -a (anti-p-AMPKa), anti-AMPKa, anti-p- peroxisome proliferator activated receptor -a (PPARa), anti-PPAR -a, anti-phosphorylated acetyl CoA carboxylase (p-ACC) ... Diabetes Care 1996, 19:1138-1146 Bujanda L, Hijona E, Larzabal M, Beraza M, Aldazabal P, Garc a- Urkia N, Sarasqueta C, Cosme A, Irastorza B, González A, Arenas JI Jr: Resveratrol inhibits nonalcoholic...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo hóa học: " The Acute Liver Injury in Mice Caused by Nano-Anatase TiO2" docx
... mcrpf: GCGGAAAAGTCTGCACAAGG, mcrpr:GGAGATAGCACAAAGTCCCACAT, 153 bp; mmiff: CCATGCCTATGTTCATCGTGA, mmifr: ATCGTTCGTGCCGCTAAAAG, 167 bp; m actin f:GAGACCTTCAACACCCCAGC, m actin r: ATGTCACGCACGAT TTCCC, ... CATCCAACCTG AAAATCGTGAG, Mnfkb1r: CCCCAAATCCTTCCCA AACT, 156 bp; mil1bf: AAGTTGACGGACCCCAAA AG, mil1br: TGAGTGATACTGCCTGCCTGA, 129 bp; mtnff: TACTGAACTTCGGGGTGATCG, mtnfr: CCAC TTGGTGGTTTGCTACG, ... Biochemical Analysis of Liver Function Liver function was evaluated with serum levels of alanine aminotransferase (ALT), alkaline phosphatase (ALP), aspartate aminotransferase (AST), lactate dehydrogenase...
Ngày tải lên: 22/06/2014, 00:20
báo cáo khoa học: "Hepatocyte growth factor incorporated chitosan nanoparticles augment the differentiation of stem cell into hepatocytes for the recovery of liver cirrhosis in mice" pptx
... http://www.jnanobiotechnology.com/content/9/1/15 TTCAGAACC-3’ (291 bp), Alb S:5’-TCAACGTCAGAGCAGAGAAGC-3’, A: 5’-AGACTGCCTTGTGTGGAAGACT-3’, (145), AFP S: 5’-GTGAAACAGACTT CCTGGTCCT -3’, A: 5’-GCC CACAGACCATGAAACAAG-3’(bp148) RT-PCR was used ... was collected to analyze alanine aminotransferase (ALT), aspartate aminotransferase (AST), and Alb Assays were carried out at Lister Metropolis Laboratory, Chennai, India using standard automated ... Kunisada T, Oyama K, Udagawa A, Nomi T, Tanaka K, Tsutsumi A, Isono M, Nakamura T, Hamada H, Sakatani T, Sell S, Sato K, Ito H, Kawasaki H: In vivo transfer of hepatocyte growth factor gene accelerates...
Ngày tải lên: 11/08/2014, 00:23
Tài liệu Báo cáo khoa học: Autophagy inhibits reactive oxygen species-mediated apoptosis via activating p38-nuclear factor-kappa B survival pathways in oridonin-treated murine fibrosarcoma L929 cells doc
... Nishimaki K, Yamagata K, Katsura K, Katayama Y, Asoh S & Ohta S (2007) Hydrogen acts as a therapeutic antioxidant by selectively reducing cytotoxic oxygen radicals Nat Med 13, 688–694 Nathan C ... a mode of type II programmed cell death, autophagy plays a major role in the degradation and recycling of intracellular materials [5] Macroautophagy, the most universal form of autophagy, is ... exhibit both autophagic and apoptotic characteristics Inhibition of autophagy increased apoptotic cell death, suggesting that autophagy has an anti-apoptotic function Importantly, we simultaneously...
Ngày tải lên: 18/02/2014, 13:20
Arsenic immobilization by calcium arsenic precipitates in lime treated soils
... Lime–NaAsO2wAs(III)x Phases Lime–Na2HAsO4•7H2OwAs(V)x Phases Ca–As–O, CaCO3, Ca(OH)2 NaCaAsO4•7.5H2O, Ca5(AsO4)3OH, CaCO3, Ca(OH)2 NaCaAsO4•7.5H2O, Ca4(OH)2(AsO4)2•4H2O, CaCO3, Ca(OH)2 Ca4(OH)2(AsO4)2•4H2O, ... Johnbaumite, Ca5(AsO4)3OH, was observed only at a CayAs molar ratio of 1:1 Calcium arsenate hydroxide hydrate, Ca4(OH)2(AsO4)2•4H2 O, was observed at CayAs molar ratios greater than 1:1 (Table and ... 2928 mgyl at a CayAs molar ratio of 1:1 and 1.4 mgyl when the CayAs molar ratio was 4:1 (Table 3) In lime–As(III)–kaolinite slurries, at CayAs molar ratios less than 2.5:1, no Ca–As–O peaks were...
Ngày tải lên: 15/03/2014, 23:48
Báo cáo khoa học: Soluble recombinant CD69 receptors optimized to have an exceptional physical and chemical stability display prolonged circulation and remain intact in the blood of mice doc
... primer pairs: for CD69NG70, 5¢-ACATATGGGCCAATACACATTC-3¢ and 5¢-ACAAAGCTTATTTGTAAGGTTTGTTACA-3¢; for CD69NV82, 5¢-ACATATGGTTTCTTCATGCTCTG-3¢ and 5¢- ACAAAGCTTATTTGTAAGGTTTGTTACA-3¢; and for CD69NS84, ... expression plasmid similar to that described previously [16] was used DNA was amplified using forward primer 5¢-CTCGAGACAATACAATTGTCCAGG-3¢, and reverse primer 5¢-ACAAAGCTTATTTGTAAGGTTTGTT ACA-3¢, and ... related diseases, such as malignant or autoimmune diseases Experimental procedures Materials All chemicals were analytical grade reagents of the highest commercially available quality Chemicals used...
Ngày tải lên: 16/03/2014, 04:20
Nonalcoholic fatty liver disease in children living in the obeseogenic society doc
... children with NAFLD and normal aminotransferases not exclude the presence of advanced disease.[16] Serum alkaline phosphatase and gamma-glutamyl transpeptidase may also be mildly abnormal Albumin, ... Y, Furusaka A, Miyahara T Diagnosis of NASH using delayed parenchymal imaging of contrast ultrasound Hepatol Res 2005;33:97-99 72 Ziol M, Handra-Luca A, Kettaneh A, Christidis C, Mal F, Kazemi ... 1996;20:230-235 63 Qayyum A, Goh JS, Kakar S, Yeh BM, Merriman RB, Coakley FV Accuracy of liver fat quantification at MR imaging: comparison of out -of- phase gradient-echo and fatsaturated fast spin-echo...
Ngày tải lên: 22/03/2014, 10:20
The natural history of non-alcoholic fatty liver disease in children: a follow-up study for up to 20 years pptx
... (serum aspartate aminotransferase (AST), alanine aminotransferase (ALT), alkaline phosphatase activity, c-glutamyl transferase (GGT), total bilirubin, albumin levels and prothrombin time), fasting ... were also common The main laboratory data gathered at the time of NAFLD diagnosis are summarised in table ALT and AST levels were each within the normal range in few patients 1 539 Hepatology Table ... transplantation at 25 years of age She was found with macrovesicular steatosis on protocol liver biopsy as early as 14 days after liver transplantation, with well-established NASH at weeks after...
Ngày tải lên: 22/03/2014, 10:20
Liver disease in children - Dr. Ahmed Al-Sarkhy, MD, MHSc, FAAP, FRCPC potx
... leukemia, lymphoma, and neuroblastoma • Primary liver tumors: Hepatoblastoma, hepatocarcinoma, and hemangioendothelioma • Presentation: hepatomegaly or abdominal distension or mass • Serum alpha-fetoprotein ... interlobular bile ducts, periportal fibrosis, and bile plugs in canaliculi and ductules Hepato-biliary scintigraphy (HIDA scan) BA NORMAL HIDA SCAN BA Management • Surgical correction (Kasai portoenterostomy) ... neonates & infants QUESTIONS Biliary Atresia (BA) • Biliary atresia is an obstruction disease of the biliary tree (mainly extra-hepatic) secondary to idiopathic inflammatory process fibrosis and...
Ngày tải lên: 28/03/2014, 09:20
Autoimmune Liver Disease in Children potx
... criteria All patients had ANA/SMA Treatment withdrawal was accomplished after a median treatment duration of 3.2 years (range, to 11 years), and remission was sustained in all for to 13 years The ... of ASC is good.15 All patients in our series were alive after a median follow-up of years Annals Academy of Medicine Distinguished Academician Lecture 2001—G Mieli-Vergani & D Vergani Four patients ... own series, normalisation of the serum aminotransferase level occurred at a median of 0.5 years (range, 0.2 to years) in children with ANA/SMA and 0.8 years (range, 0.02 to 3.2 years) in children...
Ngày tải lên: 28/03/2014, 11:20
Identification of antibacterial species in plasma treated liquids
... plasma treatment time [min] Fig 1: Inactivation kinetics of E coli as a result of plasma treatment of bacteria-containing sodium chloride (NaCl) solution ( ) as well as addition to E coli of ... plasmatreated NaCl solution immediately (ж) or 30 after plasma treatment ( ) [1] Additionally, total spectra of plasma treated water and sodium chloride solution were recorded Two absorption maxima ... number of viable microorganisms [cfu ml -1] 1,00E+09 10 plasma treated NaCl solution added to E coli with 30 delay plasma treated NaCl solution added to E coli with 30 delay plasma treated NaCl...
Ngày tải lên: 18/05/2014, 20:35
báo cáo hóa học:" Mycophenolate pharmacokinetics and pharmacodynamics in belatacept treated renal allograft recipients – a pilot study" doc
... Summarized data of IMPDH activity are presented in Figure and Table Pretransplant activity was variable and tended to be higher among CsA patients compared to belatacept patients Following transplantation, ... posttransplant, MPA C0 seemed to be higher among belatacept patients (P = 0.057, n = and n = 3) and of belatacept patients demonstrated higher MPA AUC0–9 h than the CsA patients The maximum plasma ... significantly the first weeks after transplantation Plasma concentrations of albumin, total bilirubin, and ALAT were stable throughout the study period Data analysis and statistics Results of the...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo hóa học: "The density of macrophages in the invasive front is inversely correlated to liver metastasis in colon cancer" docx
... 43(9):1348-1360 Shah A, Alberts S, Adam R: Accomplishments in 2007 in the management of curable metastatic colorectal cancer Gastrointest Cancer Res 2008, 2(3 Suppl):S13-18 Shrivastav A, Varma S, Saxena A, ... macrophages Cancer Cell 2009, 16(2):91-102 48 Mantovani A, Sica A, Allavena P, Garlanda C, Locati M: Tumor-associated macrophages and the related myeloid-derived suppressor cells as a paradigm of the ... Nonaka K, Saio M, Suwa T, Frey AB, Umemura N, Imai H, Ouyang GF, Osada S, Balazs M, Adany R, Kawaguchi Y, Yoshida K, Takami T: Skewing the Th cell phenotype toward Th1 alters the maturation of...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo hóa học: " Comparison of three rapamycin dosing schedules in A/J Tsc2+/- mice and improved survival with angiogenesis inhibitor or asparaginase treatment in mice with subcutaneous tuberous sclerosis related tumors" docx
... et al Journal of Translational Medicine 2010, 8:14 http://www.translational-medicine.com/content/8/1/14 Page of 18 a) b) Rapamycin * Untreated Asparaginase * Asparaginase+Rapamycin * # Rapamycin ... statistical significance All calculations were completed from raw data by two researchers (AN and CW) A standard unpaired t test was used to test all quantitative data, and the Mantel-Cox logrank ... treated animals were weighed at months (at the start of rapamycin treatment), and again at the time of euthanasia at ~12 months (see Additional File 3) All mice were euthanized at approximately...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo hóa học: " Updated survivals and prognostic factor analysis in myeloma treated by a staged approach use of bortezomib/thalidomide/dexamethasone in transplant eligible patients" pot
... free lambda) One developed a double IgG/kappa from a single IgG/kappa, and two patients had complete change of paraprotein (one from IgA/kappa to IgG kappa, and one from IgD/lambda to IgG/kappa) ... Garc a- Lara a J, Martínez-Martínez R, Hernández-Garc a MT, Carrera D, Besalduch J, de Arriba F, Ribera JM, Escoda L, Hernández-Ruiz B, Garc a- Frade J, Rivas-González C, Alegre A, Bladé J, San ... Mark T, Jayabalan D, Coleman M, Pearse RN, Wang YL, Lent R, Christos PJ, Lee JW, Agrawal YP, Matthew S, Ely S, Mazumdar M, Cesarman E, Leonard JP, Furman RR, Chen-Kiang S, Niesvizky R: Atypical...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo sinh học: " Differential expression of papillomavirus L1 proteins encoded by authentic and codon modified L1 genes in methylcellulose-treated mouse keratinocytes" ppt
... to change expression patterns of the other KC differentiation markers by reducing expression of basal keratins K14 and increasing expression of keratins K1 and K10 (data not shown) These data indicate ... translational levels (Fig 2) Total mRNAs were extracted %39 $ from the L1-transfected KCs and reverse-transcribed into cDNA using a reverse transcription kit (Promega, Australia) The cDNAs were analyzed ... (Covance, USA) at 4°C over night Blots were then incubated with horseradish-peroxidase(HRP)-conjugated goat antimouse IgG or HRP- conjugated goat anti-rabbit IgG (Sigma, Australia) followed by a...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo hóa học: " Complexity of VTA DA neural activities in response to PFC transection in nicotine treated rats" pdf
... patterns dynamics of VTA DA action potentials These patterns may reflect different status of neuronal network synchronization Nonlinear dynamical analysis of neural patterns demonstrated that ... analysis of neural recordings The dynamical analysis is especially relevant in the context of VTA DA neurons, which are part of neural networks that receive inputs from several other brain areas ... method and the approximated entropy to analyze VTA DA neuronal firing activity induced by systemic administration of nicotine on PFC intact and transected rats The analyses allow us to quantitatively...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học: " Focal glial activation coincides with increased BACE1 activation and precedes amyloid plaque deposition in APP[V717I] transgenic mice" pptx
... 5'-TGGGAGCCACAGCAATATAG-3' and iNOS reverse 5'-ACAGTTTGGTGTGGTGTAGG-3'; GFAP forward 5'-TCCGCGGCACGAACGAGTC-3' and GFAP reverse 5'-CACCATCCCGCATCTCCACAGTCT-3'; MCSFR forward 5'-GACCTGCTCCACTTCTCCAG-3' and ... TGC-3'; GAPDH forward 5'-TCACCAGGGCTGCCATTTGC-3' and GAPDH reverse 5'-GACTCCACGACATACTCAGC-3'; IL-6 forward 5'- CAGAAA CCGCTATGAAGT TCC-3' and IL-6 reverse 5'TGTACTCCAGGTAGCTATGG-3' TGF-β1 forward ... forward 5'CAAGTGTGGAGCAACATGTG-3' and TGFβ-1 reverse 5'CACAGCAGTTCTTCTCT GTG-3', BACE1 forward 5'CCGGCG GGAGTGG TATTATGAAGT-3' and BACE1 reverse 5'GATGGTGATGCGGAAGGACTGATT-3' PCRs were carried out...
Ngày tải lên: 19/06/2014, 22:20