experimental+investigation+of+transient+cutting+force+in+evc

A study of elliptical vibration cutting in ultra precision machining

A study of elliptical vibration cutting in ultra precision machining

... analytical force model is developed for in- depth understanding of the transient cutting mechanics and for accurate prediction of the transient cutting force In this model, transient thickness of cut ... marks in turning WCC J Cutting energy consumption in CC WCVC J Cutting energy consumption in CVC WEVC J Cutting energy consumption in EVC ∆TCC o Temperature rise in CC ∆TCVC o Temperature rise in ... 32 Chapter 3: Experimental investigation of transient cutting force in EVC 34 3.1 Characteristics of the EVC process 35 3.1.1 Transient thickness of cut 35 3.1.2...

Ngày tải lên: 09/09/2015, 10:21

175 652 0
Báo cáo khoa học: "Clinical review: The implications of experimental and clinical studies of recruitment maneuvers in acute lung injury" pptx

Báo cáo khoa học: "Clinical review: The implications of experimental and clinical studies of recruitment maneuvers in acute lung injury" pptx

... volumes Those investigators showed that, after RMs, PEEP set at cmH2O above the lower inflection point was more effective in maintaining gas exchange and minimizing inflammation and lung injury than ... lower inflection point before a sustained inflation Loop B: tidal insuflation with a PEEP below the lower inflection point after a sustained inflation Loop C: PEEP higher than the lower inflection ... the basis of our review of the literature on experimental and clinical studies, considerable uncertainty remains regarding the use of RMs in humans with ARDS RMs may have a role to play in patients...

Ngày tải lên: 12/08/2014, 19:22

7 287 0
báo cáo hóa học:" Experimental and analytical validation of a modular acetabular prosthesis in total hip arthroplasty" pot

báo cáo hóa học:" Experimental and analytical validation of a modular acetabular prosthesis in total hip arthroplasty" pot

... head) involved in the Finite Element Model Contacting areas (Acetabular Shell/liner and Liner/femoral Contacting areas (Acetabular Shell/liner and Liner/femoral head) involved in the Finite Element ... acetabular shell, liner and femoFinite Element Model of the acetabular shell, liner and femoral head The liner locking mechanism was simulated constraining all degrees of freedom of the nodes located ... six locking equatorial tabs of the liner, a total of twelve nodes of the liner FE model were fully constrained (Figure 3) 2.4 FE validation A similar loading profile to the one used in the experiment...

Ngày tải lên: 20/06/2014, 00:20

9 439 0
High-Surface-Area Catalyst Design- Synthesis, Characterization, and Reaction Studies of Platinum Nanoparticles in Mesoporous SBA-15 Silica

High-Surface-Area Catalyst Design- Synthesis, Characterization, and Reaction Studies of Platinum Nanoparticles in Mesoporous SBA-15 Silica

... The slope of the line (not shown) at both temperatures is ∼1 verifying that the measured rate is independent of the influence of transport effects Table also contains a compilation of apparent ... The minimal change in SBA-15 physical parameters after incorporation of Pt into the silica reveals that there is no significant blocking of the SBA-15 channel by Pt particles 3.2.2 Efficient Incorporation ... K) Examining the hydrogenolysis of ethane over a wide range of experimental conditions, Gudkov suggested that the ratedetermining step changes with reaction conditions At high ratios of hydrogen...

Ngày tải lên: 08/10/2015, 23:16

11 471 0
Báo cáo vật lý: "Volumetric and Thermodynamic Studies of Molecular Interactions in Ternary Liquid Mixtures at 303, 308 and 313K" pptx

Báo cáo vật lý: "Volumetric and Thermodynamic Studies of Molecular Interactions in Ternary Liquid Mixtures at 303, 308 and 313K" pptx

... value of viscosity increased with increasing concentrations of 1alkanols and decreased with increasing temperature As the number of hydrocarbon groups or the chain-length of the alcohol increased, ... that in the case of liquid systems, including electrolytic solutions, there is no serious harm in assuming cubic packing and equating b to 3.3 Gibb’s Free Energy (ΔG*) On the basis of Eyring rate ... mixtures of weakly7 or strongly interacting components.8 The study of molecular associations in organic ternary mixtures having an alcohol as one component is of particular interest since alcohols...

Ngày tải lên: 07/08/2014, 14:20

13 258 0
Báo cáo y học: "Systematic review and meta-analysis of randomised trials and cohort studies of mycophenolate mofetil in lupus nephritis" pdf

Báo cáo y học: "Systematic review and meta-analysis of randomised trials and cohort studies of mycophenolate mofetil in lupus nephritis" pdf

... original authors (mainly urine protein excretion, serum creatinine or creatinine clearance, or a combination of these) and subsequent relapse Adverse events sought included mortality, infection (especially ... evaluation of homogeneity tests in meta-analyses in pain using simulations of individual patient data Pain 2000, 85:415-424 33 L'Abbe KA, Detsky AS, O'Rourke K: Meta-analysis in clinical research Ann Intern ... residual bias in observational studies and lack of blinding in randomised trials The amount of information for MMF is greater than for cyclophosphamide and azathioprine in this indication, and...

Ngày tải lên: 09/08/2014, 08:23

10 433 0
MOLECULAR AND PHYSIOLOGICAL STUDIES OF SALT TOLERANCE IN THE SALT SECRETOR MANGROVE AVICENNIA OFFICINALIS

MOLECULAR AND PHYSIOLOGICAL STUDIES OF SALT TOLERANCE IN THE SALT SECRETOR MANGROVE AVICENNIA OFFICINALIS

... Determination of salt gland density in A officinalis leaves 67 Figure 3.4: Salt gland structure from A officinalis leaves 69 Figure 3.5: Estimation of ions in xylem sap of A officinalis ... Quantification of hormones in leaves of two-month-old A officinalis seedlings up on salt treatment 77 Figure 3.9: Quantification of hormones in roots of two-month-old A officinalis seedlings ... CCATTAGGTGGCCAGCTCTC 24 Annotation Cloning Cloning Cloning Cloning qRT-PCR primers qRT-PCR primers Cloning Cloning Cloning Cloning qRT-PCR primers qRT-PCR primers Cloning Cloning Cloning Cloning qRT-PCR primers...

Ngày tải lên: 09/09/2015, 08:13

218 765 0
Experimental and numerical modelling of spudcan penetration in stiff clay overlying soft clay

Experimental and numerical modelling of spudcan penetration in stiff clay overlying soft clay

... penetration in clayey soil is likely to be undrained Soil profile containing a thin layer of stiff clay or crust overlying soft clay, hereafter referred to simply as two-layer clay, is often found in ... penetration, resulting in a progressive indentation in the soft clay while the spudcan is still within the crust layer The progressive indentation in the soft clay is expected to mobilise increasing resistance ... penetration in sand overlying clay and in two-layer clay The findings obtained in the study of spudcan penetration in sand overlying clay may therefore not be applicable to the case of two-layer...

Ngày tải lên: 10/09/2015, 15:54

231 484 0
Experimental and theoretical studies of waste heat driven pressurized adsorption chillers

Experimental and theoretical studies of waste heat driven pressurized adsorption chillers

... simulation of a single stage pressurized adsorption cooling system in term of system behaviour and cycle performance To study experimentally the transient behaviour and performance analysis of a single ... two problems arising out of this source Firstly, a lot of care has to be exercised in handling them Particularly, during filling, they tend to get fluidized when compacting During operation, they ... required Chapter Introduction to maintain a continuous operation or flow of refrigerant since the adsorption and desorption processes are intermittent and occur over a period of time The processes...

Ngày tải lên: 11/09/2015, 10:01

221 831 0
Optical and electrical studies of silicon nanowires in photovoltaic applications

Optical and electrical studies of silicon nanowires in photovoltaic applications

... possibility of integrating MEG into the carrier generation mechanism of SiNW PV devices It aims at fabricating an array of ultra-thin SiNWs in which MEG phenomenon could be detected In Chapter ... data of SiNW surface and planar Si surface, measured using integrating sphere (b) Reflected spectral irradiance of SiNW surface comparing with that of planar Si surface; the inset shows incident ... highlighting the advantages and promising prospect of SiNWs in the design and fabrication of third generation solar cells In previous works, SiNWs were fabricated using a variety of methods, which mainly...

Ngày tải lên: 12/10/2015, 17:35

92 396 0
Pharmacokinetic and pharmacodynamic studies of mycophenolic acid in renal transplant recipients

Pharmacokinetic and pharmacodynamic studies of mycophenolic acid in renal transplant recipients

... monitoring in terms of determining the IMPDH activity in lymphocytes would be useful in the direct investigation of biologic response to MMF therapy Investigations at PD level would aid the in- depth ... target of rapamycin Mammalian target of rapamycin Molecular weight cutoff Mizoribine Nicotinamide adenine dinucleotide Other race Every morning One compartment model Phosphate Buffer Saline Pharmacodynamic ... drug regimen of a calcineurin inhibitor cyclosporine A (CsA), prednisolone and azathioprine A calcineurin inhibitor tacrolimus (TAC), a mTOR 10 (mammalian target of rapamycin) inhibitor Sirolimus...

Ngày tải lên: 28/11/2015, 13:44

207 246 0
Thermodynamics of cholesterol compounds in supercritical carbon dioxide  experimental and modeling studies

Thermodynamics of cholesterol compounds in supercritical carbon dioxide experimental and modeling studies

... binary mixture (obtained from 154 heating T profiles of Series A) 143 150 xx List of Figures Figure 7.18 Phase diagram of CBE-CBU binary mixture (obtained from 155 heating T profiles of Series B) Figure ... operation since the late 1970s for decaffeination of coffee and tea, refining of cooking oils, recovering of flavors and pungencies from spices, hops, and other plant materials A compilation of proven ... thermo-diagrams of the CBE-CBU system: Series C 153 (heating) Figure 7.16 Phase diagram of CBE-CBU binary mixture (obtained from 154 heating T profiles of Series C) Figure 7.17 Phase diagram of CBE-CBU binary...

Ngày tải lên: 17/09/2015, 17:19

280 314 0
Báo cáo khoa học: "Experimental reproduction of proliferative enteropathy and the role of IFN-gamma in protective immunity against Lawsonia intracellularis in mice" pdf

Báo cáo khoa học: "Experimental reproduction of proliferative enteropathy and the role of IFN-gamma in protective immunity against Lawsonia intracellularis in mice" pdf

... ylevitcepser ,puorg lortnoc a rof dna puorg noitcefni na rof dengissa erew ecim eerhT esuom detcefnifo noloc dna mucec cimerepyh dna degralne )D( dna ,esuom detcefninu na fo enitsetni lamron )C( ... ytlucaF eht yb detroppus saw krow sihT stnemgdelwonkcA snoitcefni tsniaga ytinummi evitcetorp a fo noitcudni eht rof γ-NFI fo ecnatropmi eht deilpmi stluser esehT enitsetni egral eht ni snoisel ... noswaL ,S tsirOcM ,S insaJ 761-951 ,601 ,2991 htaP pmoC J sitiretne evitarefilorp enicrop fo noitcudorper latnemirepxE JP eoloC ,R dnalroB ,RM notredlA secnerefeR 4002 ni ytisrevinU kuknoK fo dnuF...

Ngày tải lên: 07/08/2014, 18:21

3 480 0
Báo cáo y học: "Interaction of mumps virus V protein variants with STAT1-STAT2 heterodimer: experimental and theoretical studies" pps

Báo cáo y học: "Interaction of mumps virus V protein variants with STAT1-STAT2 heterodimer: experimental and theoretical studies" pps

... STAT2 in vitro The relevance of these theoretical findings in the function of V protein and virulence of mumps virus variants are discussed Results In order to determine the effect of protein V of ... loss of efficiency in inducing degradation of the STAT1 protein This could explain the differences reported in the replication and transcription of genes in response to interferon during infection ... with proteins of the IFN signaling pathway, finding differences in their capacity to bind STAT proteins In addition, in silico three- dimensional structure models of VWT and VGly proteins supported...

Ngày tải lên: 12/08/2014, 01:22

10 311 0
Báo cáo y học: "Influence of enrollment sequence effect on observed outcomes in the ADDRESS and PROWESS studies of drotrecogin alfa (activated) in patients with severe sepsis" pptx

Báo cáo y học: "Influence of enrollment sequence effect on observed outcomes in the ADDRESS and PROWESS studies of drotrecogin alfa (activated) in patients with severe sepsis" pptx

... terminated at the recommendation of the safety monitoring board because of a low likelihood of meeting the prospectively defined objective of demonstrating a significant reduction in the risk of ... failure [8] The presence of a sequence effect in low-risk patients only may suggest the difficulty of making the diagnosis of severe sepsis in this clinical setting The influence of protocol violations ... applicability of the study results to a more general severe sepsis population The use of severity scoring systems in clinical trials may require training and validation of the training to ensure...

Ngày tải lên: 13/08/2014, 11:22

13 341 0
Experimental realization and theoretical studies of novel all optical devices based on nano scale waveguides

Experimental realization and theoretical studies of novel all optical devices based on nano scale waveguides

... such as χ(3) switching or n(2) switching in SOA, the main advantage of AMOI scheme is the capability of achieving the switching gain Switching gain describes the ability of using small signal beam ... characteristics of semiconductor quantum well (QW) in comparison with the bulk medium in affecting the switching performance of EUPT In chapter VII, experimental realization of EUPT in an integrated ... of input signal at switch-on state : Optical power of input signal at switch-off state : Extinction ratio of signal : Propagation constant of light in waveguide i 18 : Effective propagation index...

Ngày tải lên: 09/09/2015, 08:14

234 504 0
analytical and numerical studies of bose   einstein condensates

analytical and numerical studies of bose einstein condensates

... temperature of the order of 100nK is required so that λdB is of the order of interatomic spacing At the same time, a gaseous state of the system has to be maintained to avoid collision of particles ... this section, while those in strongly interacting regime will be studied in the next section For a system of non-interacting atoms or weakly interacting atoms, the following normalized trial wavefunction ... selftrapping can be well explained by the nonlinear band structure in a periodic potential, where the nonlinear band structure arises due to the interparticle interaction in the GPE Chapter Introduction...

Ngày tải lên: 10/09/2015, 15:51

166 460 0
Experimental and numerical investigation of novel pine oil biofuel in a diesel engine

Experimental and numerical investigation of novel pine oil biofuel in a diesel engine

... 131 OPERATION OF PINE OIL IN DUAL FUEL MODE 133 5.1 Investigation of evaporation and engine characteristics of pine oil biofuel fumigated in the inlet manifold of a diesel engine 133 5.1.1 ... type of biofuel, pine oil, for the purpose of fueling diesel engine Significantly, pine oil biofuel is unique in that the feedstock originates from forest and is produced from the resins of pine ... invoking the concept of fumigation Since pine oil is a less viscous fuel, in the likes of alcohols, it was fumigated in the inlet manifold of the engine, while diesel was injected through main...

Ngày tải lên: 12/09/2015, 11:01

156 236 0
Xem thêm
w