experience from the field with a focus on africa

báo cáo sinh học:" Information needs of health care workers in developing countries: a literature review with a focus on Africa" doc

báo cáo sinh học:" Information needs of health care workers in developing countries: a literature review with a focus on Africa" doc

... problems with understanding and/or implementation of international and/or national guidelines The South Africa study, mentioned above, looked at national guidelines Also a review on India and diabetes, ... churchowned primary health care facilities in Dar Es Salaam and other Tanzanian coast regions East Afr Med J 2001, 78(10):510-514 Ratanawijitrasin S, Soumerai SB, Weerasuriya K: Do national medicinal drug ... investigate further the link between lack of information and feelings of professional isolation and general dissatisfaction among rural health workers How important is lack of information as a contributing...

Ngày tải lên: 18/06/2014, 17:20

13 558 0
báo cáo khoa học: "The occurrence and management of fluid retention associated with TKI therapy in CML, with a focus on dasatinib" pptx

báo cáo khoa học: "The occurrence and management of fluid retention associated with TKI therapy in CML, with a focus on dasatinib" pptx

... Khorashad JS, Gabriel IH, Chaidos A, Olavarria E, Goldman JM, Apperley JF, Marin D: Pleural effusions in patients with chronic myeloid leukaemia treated with dasatinib may have an immune-mediated pathogenesis ... ongoing This article has focused specifically on the management of pleural effusions associated with dasatinib therapy Fluid retention AEs have been associated with all three BCR-ABL inhibitors ... years) and/ or patients with advanced CML disease The CML Program is sponsored by a grant from the Norris Foundation The authors take full responsibility for the content of the paper but thank...

Ngày tải lên: 10/08/2014, 22:20

6 338 0
The herpetofauna of the peruvian dry forest along the andean valley of the marañón river and its tributaries, with a focus on endemic iguanians, geckos and tegus

The herpetofauna of the peruvian dry forest along the andean valley of the marañón river and its tributaries, with a focus on endemic iguanians, geckos and tegus

... in Balsas, in the Southern part of the Region Amazonas, in Chacanto, Region Cajamarca and in various localities in the Region La Libertad (San Vicente/Pusac, Santa Rosa/El Tingo, Vijus, Chagual, ... Pramuk 1999, Brack 2004) The Huancabamba Depression in the Piura, Cajamarca, Amazonas and San Martin Regions is the major structural and physiographic break of the Andes consisting of a complex system ... Region Cajamarca from elevations between 1100-1500 m a. s.l (CisnerosHeredia et al 2008) We collected our specimens near Santa Rosa de la Yunga, Region Cajamarca, and in Zapatalgo, Region Amazonas...

Ngày tải lên: 19/11/2015, 15:51

264 493 0
PUBLIC PERCEPTIONS OF URBAN AIR POLLUTION WITH A FOCUS ON DEVELOPING COUNTRIES potx

PUBLIC PERCEPTIONS OF URBAN AIR POLLUTION WITH A FOCUS ON DEVELOPING COUNTRIES potx

... Saksena Sumeet Saksena is a Fellow in the Research Program at the East-West Center He is also Affiliate Faculty at the Department of Urban And Regional Planning, University of Hawai`i at Manoa ... Perceptions about the health effects of air pollution There has been a realization in the recent times that health impacts are a major way by which people realize the extent of the risks associated with ... technical terms and jargons made the information seem irrelevant to people The issue of spatial scale is important too – people cannot relate to regional or national statistics, but demand local statistics...

Ngày tải lên: 06/03/2014, 16:20

32 381 0
From The Bit Bucket: (A)Musings on Engineering, Supervision, and Management Francis W. Porretto pdf

From The Bit Bucket: (A)Musings on Engineering, Supervision, and Management Francis W. Porretto pdf

... in an assignment as a tactic of his own for manipulating Smith Anyway, every group accumulates some scutwork, and the manager can't always take it on himself Two other approaches are available ... encourage the others in the group to play Jones's game The common factor between these two approaches is that each one gives Jones a reason to want to what Smith wants him to In the first case, the ... in the past three years Now and then, it's made him feel more like a father than a manager But then, most really good managers are fathers or mothers; parenthood is an invaluable source of experiences...

Ngày tải lên: 27/06/2014, 23:20

84 297 0
ICTs for e-EnvironmentGuidelines for Developing Countries, with a Focus on Climate Change pptx

ICTs for e-EnvironmentGuidelines for Developing Countries, with a Focus on Climate Change pptx

... Meteorological Organization (WMO), the World Health Organization (WHO), the International Civil Aviation Organization (ICAO), and UN-Habitat Additional information on WSIS Action Line C7 on e-Environment ... such as Las Vegas, forest loss in the Amazon, rapid oil and gas development in Wyoming and Canada, forest fires across sub-Saharan Africa and the decline of the Aral Sea in Central Asia and Lake ... organizations on the basis of criteria A similar approach might also be useful to track e-Environment related organizations as well as the many applications that are being created on an ongoing basis...

Ngày tải lên: 28/06/2014, 12:20

182 275 0
báo cáo khoa học: "Primary malignant mixed Müllerian tumor arising from the mesorectum with a synchronous ovarian cancer: a case report and review of the literature" ppsx

báo cáo khoa học: "Primary malignant mixed Müllerian tumor arising from the mesorectum with a synchronous ovarian cancer: a case report and review of the literature" ppsx

... Ovarian adenocarcinoma, synchronous Operation Death at 10 months Unknown CT, computed tomography; DTIC, Dacarbazine; RT, radiotherapy mass affected the bladder and the rectosigmoid colon Laboratory ... papillary Operation, RT carcinoma, metachronous Death at 11 months [17] 1989 El-Jabbour et al 76 Ascending colon peritoneum Heterologous Colonic adenocarcinoma, synchronous Operation Death at 14 days ... end-to-end anastomosis was performed Unfortunately, 10 days later, the patient had an anastomotic leakage caused by the penetration of the drain tube which was noted when a colonoscopy was performed Consequently,...

Ngày tải lên: 11/08/2014, 03:20

5 475 0
Báo cáo y học: " Paratuberculosis control: a review with a focus on vaccination" ppt

Báo cáo y học: " Paratuberculosis control: a review with a focus on vaccination" ppt

... interfere with national tuberculosis eradication programs The latter is in fact the major hurdle affecting MAP vaccine approval for cattle by medical and agricultural authorities all over the world and ... the avian tuberculin indicates infection or vaccination with avian type mycobacteria and allows to rule out mammal tuberculosis infection according to standardized criteria An additional drawback ... eradication a realistic goal? Is it necessary? Is it profitable for the society in general? Answers to these questions are not readily available because we lack accurate information on the actual...

Ngày tải lên: 11/08/2014, 08:21

17 512 0
Essays in modeling health care expenditures with a focus on singapore

Essays in modeling health care expenditures with a focus on singapore

... of Japan and Sweden, while under-five mortality rate of Germany is 4, Australia 5, U.K 6, Canada and U.S What makes Singapore’s achievement laudable is that it has done so at a fraction of the ... insurance without personal savings account 19 Another argument advanced by the advocates of MSA (Ham, 1996; Prescott and Nichols, 199826; Phua and Yap, 1998) is that the saving approach resolves the ... are made in absence of any data which cast doubt on their reliability In fact, the lack of primary data has been an issue in Singapore case The paper by Chia and Tsui (2005) deserves a special...

Ngày tải lên: 10/09/2015, 15:53

189 311 0
Clearing the Waters: A focus on water quality solut ions pptx

Clearing the Waters: A focus on water quality solut ions pptx

... and data-sharing and management institutions Resources are needed to build national and regional capacity to collect, manage, and analyze water quality data Improve communication and education ... in the Americas, Europe, Australasia, and most significantly, in Africa and the eastern Mediterranean (Figure 1) Beyond nitrate contamination, agricultural activities are also linked to the salinization ... affect flora and fauna as well as economics and politics A classic example of a water system severely affected by human development is the Aral Sea, fed by the Amu Darya and Syr Darya The Aral...

Ngày tải lên: 06/03/2014, 15:21

91 473 0
The Project Gutenberg eBook, American Addresses, with a Lecture on the Study of Biology, by Thomas potx

The Project Gutenberg eBook, American Addresses, with a Lecture on the Study of Biology, by Thomas potx

... day was signalised by the apparition of the sun, the stars, the moon, and the planets; that, on the fifth day, aquatic animals originated within the waters; that, on the sixth day, the earth gave ... the space of six natural days, in such a manner that, on the first of these days, light appeared; that, on the second, the firmament, or sky, separated the waters above, from the waters beneath ... that these operations of degradation and elevation might compensate each other; and that thus, for any assignable time, the general features of our planet might remain what they are And inasmuch...

Ngày tải lên: 28/06/2014, 19:20

330 324 0
Báo cáo khoa học: "Suppressive effect of culture supernatant of erythrocytes and serum from dogs infected with Babesia gibsoni on the morphological maturation of canine reticulocytes in vitro" pdf

Báo cáo khoa học: "Suppressive effect of culture supernatant of erythrocytes and serum from dogs infected with Babesia gibsoni on the morphological maturation of canine reticulocytes in vitro" pdf

... derapmoc sdica cielcun dna ,sdica onima ,enoihtatulg decuder ,etahpsohpirt la te niassoH rigmalA dammahoM 071 .sdnab ralucelom dradnats eht etacidni srettel dna ssam ralucelom tnerappa htiw sdnab ... detcefni-inosbig aisebaB ni aimena fo sisenegohtap eht dna egamad evitadixo etycorhtyre eht no segahporcam fo tceffe ehT Y edeaM ,O otamaY ,M ikasamaY ,Y akustO 81 651-051 ,55 ,2002 siD tcefnI J npJ tnatanrepus ... otamaY ,Y akustO ,H onasA ,M ikasamaY 22 978-668 ,45 ,4791 tsevnI nilC J ycneicifed esaditoelcun-'5 enidimiryp etycorhtyre namuh htiw aimena citylomeh yratidereH SW smadA ,RS sirraH ,ED ailgaP...

Ngày tải lên: 07/08/2014, 20:23

6 484 0
Báo cáo khoa học: " Protection of chickens from Newcastle disease with a recombinant baculovirus subunit vaccine expressing the fusion and hemagglutinin- neuraminidase proteins" pdf

Báo cáo khoa học: " Protection of chickens from Newcastle disease with a recombinant baculovirus subunit vaccine expressing the fusion and hemagglutinin- neuraminidase proteins" pdf

... 5' TCCAGGTGCAAGATGGGCTCC 3' 5' AGGGAAACCTTCGTTCCTCAT 3' 5' TCAATCATGGACCGCGCCGTT 3' 5' CGCAGAAGATAGGTGATACAA 3' 5' ACATTCAGGACACAATATGGG 3' 5' CACAGGCTGCTGTTGGGTAT 3' 5' ACAAGAGTCAATCATGGACCG ... H, Tawara H, Nakazawa H, Sumida M, Matsubara F, Aoyama S, Iritani Y, Hayashi Y, Kamogawa K Expression of the Newcastle disease virus (NDV) fusion glycoprotein and vaccination against NDV challenge ... fusion and hemagglutininNeuraminidase antigens Avian Dis 1996, 40, 770-777 Iritani Y, Aoyama S, Takigami S, Hayashi Y, Ogawa R, Yanagida N, Saeki S, Kamogawa K Antibody response to Newcastle disease...

Ngày tải lên: 07/08/2014, 20:24

8 315 0
Bóa cáo y học: "Does productivity influence priority setting? A case study from the field of CVD prevention" ppsx

Bóa cáo y học: "Does productivity influence priority setting? A case study from the field of CVD prevention" ppsx

... is to aid decision-makers, one can question if all dollars have the same value "We conclude that although all costs are equal, in a health economic evaluation, some may be more equal than others." ... strategies and it is necessary to analyse the incremental effects and costs of each The health gains of any particular intervention depend, among other things, on the risk of the target group Therefore, ... production was estimated as the difference between the annual gross income for the patients with an MI or stroke and the general population The estimations were based on all patients between 1995 and...

Ngày tải lên: 13/08/2014, 11:22

6 296 0
The modern practices of hydraulic fracturing   a focus on canadian resources

The modern practices of hydraulic fracturing a focus on canadian resources

... operations in a way that safeguards the environment and human health Many of the concerns raised about hydraulic fracturing are related to the production of oil and gas and can be associated with the ... operations in a way that safeguards the environment and human health Many of the concerns raised about hydraulic fracturing are related to the production of oil and gas and can be associated with ... Columbia and north central Alberta (see map in Figure 19) 186 The play area varies, from traditional shale gas along the Alberta/British Columbia border to tight calcareous sandstone in central Alberta...

Ngày tải lên: 04/10/2014, 23:07

229 558 0
Do Rural Infrastructure Investments Benefit the Poor? Evaluating Linkages: A Global View, A Focus on Vietnam

Do Rural Infrastructure Investments Benefit the Poor? Evaluating Linkages: A Global View, A Focus on Vietnam

... boreholes and hand pumps) and increased local organizational capacity/social capital Village water committees have been created in projects evaluated in India, Paraguay, and Sri Lanka, and many of these ... educated, i.e at least one female in the household has more than a primary school education (Jalan and Ravallion, 2001) 77 As noted in Part II (Non-economic/Social Impact), a rural electrification ... villagers Nontraditional health instructors, such as lay people, can serve as promoters in health and sanitation campaigns § A study of health and sanitation issues in West Africa noted that targeting...

Ngày tải lên: 26/04/2016, 07:33

65 522 0
LX Thuy_tính toán vỏ có lỗ giảm yếu và gân gia cường chịu sóng xung kích: Effect of Some Factors on the Dynamic Response of  Reinforced Cylindrical Shell with a Hole on Elastic  Supports Subjected to Blast Loading

LX Thuy_tính toán vỏ có lỗ giảm yếu và gân gia cường chịu sóng xung kích: Effect of Some Factors on the Dynamic Response of Reinforced Cylindrical Shell with a Hole on Elastic Supports Subjected to Blast Loading

... in the middle position, with a = 0.3 m; Case 2: The shell has no hole (a = 0) Acting load: the shock waves act uniformly to the direction of normal on the shell surface according to the law: ... 1: The shell has a square abatement hole with the side a = 0.3 m (Basic problem): Using the established Stiffened_SC_Shell _withhole program, the authors solved the problem with the calculating ... equation and may be solved by using the Newmark’s direct integration method Based on the established algorithm the authors have written the program called Stiffened_SC_Shell_Withhole in Matlab environment...

Ngày tải lên: 02/11/2016, 22:48

8 772 0
Impact Of Tariff Cuts On Pakistan: A Computable General  Equilirium Analysis With Particular Focus On Main Exports And Regional Disparities

Impact Of Tariff Cuts On Pakistan: A Computable General Equilirium Analysis With Particular Focus On Main Exports And Regional Disparities

... Poverty Alleviation Fund Public Sector Enterprises Pakistan Standard Industrial Classification Pakistan Standard Trade Classification Real Effective Exchange Rate Regional Equation Systems Rs SAM SAPs ... patterns of association among Pakistan’s political and trade regimes, socioeconomic indicators, and regional conflicts and disparities It also makes a case for adding a regional dimension to the proposed ... Even after this traumatic event, the relationships among the four regions that remain in (West) Pakistan have not been harmonious Reasons for regional friction have ranged from the distribution...

Ngày tải lên: 12/12/2016, 20:23

295 245 0
Báo cáo y học: "Primary lower limb lymphedema: a focus on its functional, social and emotional impac"

Báo cáo y học: "Primary lower limb lymphedema: a focus on its functional, social and emotional impac"

... such as vascular surgeons are more familiar with the management of the disorder in the acute phase Although the disease is rare, primary care physicians as first contact care givers and through the ... the continuity of care that they can offer, may play an important role in the diagnosis and the monitoring of the long-term impact of lymphedema on physical and emotional or social domains The ... dermatologists, may represent an essential issue for an optimal overall management of cases with a congenital primary lymphedema [14] Conclusions Assessing the impact of the duration and severity of the condition...

Ngày tải lên: 25/10/2012, 11:40

5 444 0
w