... is aimed at collecting both quantitative and qualitative data to make use of analytical and exploratory- interpretive paradigms in applied linguistics The quantitative and qualitative data collected ... cultural material later, after they have mastered the basic grammar and vocabulary of the language The last one is the lack of adequate training HCC teachers may not have been adequately trained ... and foreign language learning, cultural topics in foreign language learning, goals for incorporating culture into the foreign language class, and Comparing and Contrasting as activities of raising...
Ngày tải lên: 07/11/2012, 15:06
INCORPORATING ENGLISH CULTURAL ELEMENTS INTO ENGLISH TRAINING WITH THE COMPARING CONTRASTING APPROACH a CASE OF TOURISM STUDE
... cultural material later, after they have mastered the basic grammar and vocabulary of the language The last one is the lack of adequate training HCC teachers may not have been adequately trained ... is aimed at collecting both quantitative and qualitative data to make use of analytical and exploratory- interpretive paradigms in applied linguistics The quantitative and qualitative data collected ... knowledge and foreign language learning , cultural topics in foreign language learning, goals for incorporating culture into the foreign language class, and Comparing and Contrasting as activities...
Ngày tải lên: 07/09/2013, 13:41
two-word phrasal verbs with the particle in that require into when used with an object
... things have been a bit confused at our office lately broken in part.adj After you break in a new mechanical device or a car, a pair of shoes, or people at a new job, they are broken in l don't want ... mileage and a cleaner engine 321 13 We're planning to for a few weeks Would you mind watering our plants until we return? 14 David put a pool table and a pinball machine in his basement ... investigated a break-in at the liquor store break in p.v When you break in a new mechanical device or a car, you use it slowly and carefully until you are sure it ready for heavier use When you break...
Ngày tải lên: 01/11/2013, 16:20
Tài liệu Báo cáo khoa học: Insights into the interaction of human arginase II with substrate and manganese ions by site-directed mutagenesis and kinetic studies Alteration of substrate specificity by replacement of Asn149 with Asp docx
... GATGCCAATGCTGACATCAAC-3¢ for His145Asn and 5¢-TGACATCGACACACCCC-3¢ for Asn149Asp Fluorescence spectra and thermal inactivation studies Fluorescence measurements were made at 25 °C on a Shimadzu ... totally different substrate specificities, is considered for arginase and agmatinase [20] Such substrate discrimination is particularly important for mammalian arginase II and agmatinase, as both ... required for maximal catalysis by both enzyme forms [9] Mammalian and all other known arginases also shares a significant sequence homology with all sequenced agmatinases (agmatine ureo hydrolase,...
Ngày tải lên: 20/02/2014, 02:21
Tài liệu Painting with print: Incorporating concepts of typographic and layout design into the text of legal writing documents docx
... summary or roadmap paragraphs In those studies, headings are also called “signaling topic structures” and summaries or roadmaps are called “advance organizers.” Both signals and advance organizers ... groundwork for memory Advance organizers such as roadmaps or summaries create a learning base that the reader can call upon as pre-learned material when later introduced to the material in more ... Tinker and Paterson reached involved the use of capitalization Contrary to what many people might think, the use of all capital letters in a heading (“all caps”) actually dramatically decreases...
Ngày tải lên: 21/02/2014, 05:20
Báo cáo khoa học: Complexes of Thermoactinomyces vulgaris R-47 a-amylase 1 and pullulan model oligossacharides provide new insight into the mechanism for recognizing substrates with a-(1,6) glycosidic linkages docx
... A, Ohtaki A, Kaji A, Tonozuka T & Sakano Y (2002) Crystal structures of Thermoactino˚ myces vulgaris R-47 a- amylase (TVA I) at 1.6 A reso˚ resolution lution and a- amylase (TVA II) at 2.3 A J Mol ... Henrissat B (1991) A classification of glycosyl hydrases based on amino acid sequence similarities Biochem J 280, 309–316 Tonozuka T, Mogi S, Shimura Y, Ibuka A, Sakai H, Matsuzawa H, Sakano Y & Ohta ... Tonozuka T, Matsuzawa H & Sakai H (1998) Conversion of neopullulanase -a- amylase from Thermoactinomyces vulgaris R-47 into an amylopullulanase-type enzyme J Biochem 123, 275–282 Kamitori S, Abe A, ...
Ngày tải lên: 16/03/2014, 14:20
Báo cáo khoa học: "Depression and anxiety in epilepsy: the association with demographic and seizure-related variables" ppt
... significance Statistical analysis was performed using a commercially available statistical package (SPSS for Windows version 13; SPSS, Chicago, IL, USA) Results Table presents the demographic data and ... The base omitted factors are SF < 1/year, SF > 1/year, CFE, IGE, AED1, AED2, AED 3, age and disease duration tions have clearly established that partial seizures, particularly complex partial seizures ... variables are presented as percentages Continuous variables are presented as Mean ± SD Page of (page number not for citation purposes) Annals of General Psychiatry 2007, 6:28 http://www.annals-general-psychiatry.com/content/6/1/28...
Ngày tải lên: 08/08/2014, 23:20
Báo cáo y học: " A case of spotted fever group rickettsiosis imported into the United Kingdom and treated with ciprofloxacin: a case repor" pptx
... normal and malarial films were negative C-reactive protein was slightly raised at 29 Blood samples were collected for serological studies on initial presentation and weeks later (Table 1) A working ... clinical notes were reviewed by RR All authors read and approved the final manuscript Consent Written informed consent was obtained from the patient for publication of this case report and any accompanying ... eschar with associated regional lymphadenopathy – as occurred in our patient – makes the diagnosis of African tick bite fever highly probable As is the case with most common rickettsioses, African...
Ngày tải lên: 11/08/2014, 23:21
Squark decays into W and Z Bosons in the MSSM with complex parameter
Ngày tải lên: 11/03/2015, 07:59
Insights into the mechanism of safingol and its potential to synergize with anti cancer drugs
... xii List of Abbreviations 2-NBDG 3-MA 5-FU 7AAD Abs AIF ANOVA ANT AMPK APAF-1 APP Ara-C Apo2-L Atg ATP AVO BA1 Bcl-2 BH BSA CD95 Cdk Chk CI CMA 2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2deoxyglucose ... such as Fas-associated death domain (FADD), which interacts with pro-caspase and 10 to form the death-inducing signaling complex (DISC) Pro-caspase and 10 are self-cleaved Activated caspase and ... membrane (phagophore) Atg activates Atg 12 and Atg 12 is transferred to Atg 10 before conjugates with Atg Then, Atg 16 conjugates to Atg12-Atg5 and attaches Atg12-Atg5-Atg16 complex to phagophore...
Ngày tải lên: 11/09/2015, 10:02
On teaching english with detailed examples and an enquiry into the definition of poetry (1901) Alexander bain
Ngày tải lên: 16/02/2016, 15:02
Tapping into the Power of Text Mining
... ultimately understandable patterns in data” The analysis of data in KDD aims at finding hidden patterns and connections in these data By data we understand a quantity of facts, which can be, for ... instance, data in a database, but also data in a simple text file Characteristics that can be used to measure the quality of the patterns found in the data are the comprehensibility for humans, validity ... retrieval, natural language processing and information extraction In all of these areas we also apply data mining methods and statistics to handle their specific tasks: Information Retrieval (IR) Information...
Ngày tải lên: 31/08/2012, 16:46
Báo cáo y học: " Experimental ablation of the pancreas with high intensity focused ultrasound (HIFU) in a porcine model"
... Ltd Tokyo, Japan) Statistical analysis Data were expressed as means ± standard deviation (SD), and comparisons were performed with Wilcoxon rank sum test All statistical analyses were carried out ... was performed, and the pancreas was ablated directly through the surface of the pancreas with an HIFU transducer In the Group B and Group C, extracorporeal HIFU ablation the pancreas was performed ... vacuolated, and mitochondria swelled to a circular shape with a clear matrix and short or disappeared cristae, which were vacuolar appearances Smooth and rough endoplasmic reticulum expanded and became...
Ngày tải lên: 25/10/2012, 11:18
Báo cáo y học: "ISOLATION OF CHLAMYDIA PNEUMONIAE FROM SERUM SAMPLES OF THE PATIENTS WITH ACUTE CORONARY SYNDROME"
... TTACAAGCCTTGCCTGTAGG 3’, oCP2 – 5’ GCGA TCCCAAATGTTTAAGGC 3’) and nested (iCPC - 5’ TTATTAATTGATGGTACAATA 3’, iCPD - 5’ ATCTACGGCAGTAGTATAGTT 3’) primers were used as published (24) µl of DNA was added to reaction ... bacterial DNA was extracted from the same volume of whole serum with QIAmp Blood Midi Kit (QIAGEN, Valencia, CA) according to the manual Bacterial DNA was also extracted from the bacterial particles ... serum was immediately separated and stored at - 80° C until assayed C.pneumoniae-specific IgA and IgG antibodies were evaluated by using Chlamydia pneumoniae-IgG-ELISA medac plus and Chlamydia pneumoniae-IgA-ELISA...
Ngày tải lên: 26/10/2012, 08:57
An investigation into the reality of teaching and learning speaking skills to the 2nd year non-major english students at pre-intermediate level of proficiency at hanoi university of industry
... speaking materials and appropriate time for teaching and learning English speaking 24 Table 4: Pre-speaking activities carried out by teachers and students’ responses 26 Table 5: While-speaking activities ... Administrators Can Do Centre for Adult English Language Acquisition (CAELA) Retrieved from www.cal.org/caela/els_resources Nunan, D (1989) Designing Tasks for the Communicative Classroom Cambridge: Cambridge ... functions Chapter provides theoretical background about Communicative Language Teaching, speaking skills, three main stages of speaking and motivation in a speaking lesson Chapter investigates the...
Ngày tải lên: 07/11/2012, 14:50
An investigation into the style of the english language used in advertising slogans issued by some world - famous airlines
... Germany Fly Euro Shuttle! Air Canada Defy obstacles Air Canada Canada World class, worldwide Air France France Air France One of the best places on earth AIR INDIA India New Zealand your place ... Germany Lufthansa There's no better way to fly 33 Malaysia Airlines Malaysia Going beyond expectations 34 Northwest Airlines 35 Pakistan International Airline 36 PAL 37 PSA 38 Qantas Australia Qantas ... everything Air New Zealand Air Pacific Your Island in the Sky Air Tanzania The wings of Kilimanjaro 10 Alitalia 11 America West Airlines The USA Lower fares, fewer restrictions 12 American Airlines...
Ngày tải lên: 07/11/2012, 14:54