example of a story from the doc

Báo cáo khóa học: Biochemical and molecular characterization of a laccase from the edible straw mushroom, Volvariella volvacea docx

Báo cáo khóa học: Biochemical and molecular characterization of a laccase from the edible straw mushroom, Volvariella volvacea docx

... min; then a final extension at 72 °C for 10 The primers for lac1 PLAC1F (5¢-AGCTTT CATTCCCAGTGATTG-3¢) and PLAC1R (5¢-AACGAG CTCAAGTACAAATGACT-3¢) were designed according to our cloned cDNA (GenBank ... primers The putative N-glycosylation site is boxed; *; stop codon The putative polyadenylation signals (TATAAA and CATAAA) are in white on a black background Ó FEBS 2003 Laccase gene from Volvariella ... colour and the spectral maxima near 600 nm that characterize all the blue oxidases Furthermore, guaiacol is a poor substrate for the enzyme In both cases, lac1 resembles the ÔwhiteÕ laccase (POXA1),...

Ngày tải lên: 07/03/2014, 15:20

11 703 0
Báo cáo khoa học: Phosphorylation modulates the local conformation and self-aggregation ability of a peptide from the fourth tau microtubule-binding repeat pdf

Báo cáo khoa học: Phosphorylation modulates the local conformation and self-aggregation ability of a peptide from the fourth tau microtubule-binding repeat pdf

... negative charge at neutral pH, affects the electrostatic potential and quite often the conformation of the modified protein Even in the absence of rearrangement, the change in the electric field and ... R4 and pR4, a local conformational difference was deduced from the proton chemical shift deviation of NH and aH However, there was no remarkable structural perturbation from the CD spectra Furthermore, ... Correas I, Nieto A & Avila J (1988) Tau factor polymers are similar to paired helical filaments of Alzheimer’s disease FEBS Lett 236, 150–154 42 Mendieta J, Fuertes MA, Kunjishapatham R, SantaMaria...

Ngày tải lên: 16/03/2014, 05:20

9 428 0
Báo cáo khoa học: Purification, characterization, cDNA cloning and nucleotide sequencing of a cellulase from the yellow-spotted longicorn beetle, Psacothea hilaris ppt

Báo cáo khoa học: Purification, characterization, cDNA cloning and nucleotide sequencing of a cellulase from the yellow-spotted longicorn beetle, Psacothea hilaris ppt

... N-Terminal amino-acid sequencing analysis indicated that the mature protein of P hilaris cellulase was a truncated form, which lacked a signal peptide composed of the first 21 amino acids Therefore, the ... degradation activity of P hilaris cellulase against crystalline cellulose, Avicel (Merck) was used under the same conditions as the CMCase assay Optimal pH for P hilaris cellulase activity against ... Cleavage of structural proteins during the assembly of the head of bacteriophage T4 Nature (London) 224, 680–685 12 Tokuda, G., Saito, H & Watanabe, H (2002) A digestive betaglucosidase from the...

Ngày tải lên: 17/03/2014, 10:20

6 361 0
Tài liệu Cancer Pain Management: A perspective from the British Pain Society, supported by the Association for Palliative Medicine and the Royal College of General Practitioners docx

Tài liệu Cancer Pain Management: A perspective from the British Pain Society, supported by the Association for Palliative Medicine and the Royal College of General Practitioners docx

... physicians and other healthcare professionals who treat pain from cancer at any stage of the disease with the hope of raising awareness of the types of therapies that may be appropriate and increasing ... working and the education of all healthcare professionals involved in the treatment of cancer pain • The principles of pain management and palliative care for adult practice are relevant to paediatrics, ... in particular may have under-treated pain Primary care teams supported by palliative care teams are best placed to initiate and manage cancer pain therapy, but education of patients, carers and...

Ngày tải lên: 14/02/2014, 21:20

116 548 0
Tài liệu The Days of Bruce Vol 1 A Story from Scottish History ppt

Tài liệu The Days of Bruce Vol 1 A Story from Scottish History ppt

... rumor ceased, and Macduff assumed, with great appearance of zeal, the guardianship of the young Earl of Fife and his sister, an office bequeathed to him under the hand and seal of the earl, his ... which had escaped the cupidity of Edward, was arranged with care upon the various altars; in the centre of the church was placed the abbot's oaken throne, which was to supply the place of the ancient ... shout that hailed the appearance of the newly-anointed king, as he CHAPTER V 32 paused a moment on the great stone staircase, leading from the principal doors of the abbey to the abbey yard For...

Ngày tải lên: 22/02/2014, 03:20

196 350 0
Tài liệu Báo cáo Y học: Expression and characterization of active site mutants of hevamine, a chitinase from the rubber tree Hevea brasiliensis docx

Tài liệu Báo cáo Y học: Expression and characterization of active site mutants of hevamine, a chitinase from the rubber tree Hevea brasiliensis docx

... 5¢-GATGGTATTGATTTTGCCATAGAGCATGGTTCA-3¢ Anti-sense strand 5¢-TGAACCATGCTCTATGGCAAAATCAATACCATC-3¢ Sense strand 5¢-TTGGATGGTATTGATTTTAACATAGAGCATGGTTCAACC-3¢ Anti-sense strand 5¢-GGTTGAACCATGCTCTATGTTAAAATCAATACCATCCAA-3¢ ... strand 5¢-CAGGGTTGAACCATGCGCTATGGCAAAATCAATACCATC-3¢ Sense strand 5¢-TATGTATGGGTTCAATTCTTTAACAATCCACCATGCCAG-3¢ Anti-sense strand 5¢-CTGGCATGGTGGATTGTTAAAGAATTGAACCCATACATA-3¢ This mutant was made ... 5¢-GGTTGAACCATGCTCTATGTTAAAATCAATACCATCCAA-3¢ Sense strand 5¢-GGTATTGATTTTGACATAGCGCTATGTCAAAATCAATACC-3¢ Anti-sense strand 5¢-GTACAGGGTTGAACCATGCGCTATGTCAAAATCAATACC-3¢ Sense strand 5¢-GATGGTATTGATTTTGCCATAGCGCATGGTTCAACCCTG-3¢ Anti-sense...

Ngày tải lên: 22/02/2014, 04:20

9 616 0
Cell Biology and Cancer under a contract from the National Institutes of Health doc

Cell Biology and Cancer under a contract from the National Institutes of Health doc

... life; as a class, they assemble data about the population as a whole Students examine the data the class assembles and draw a set of important generalizations about cancer from them These generalizations ... the power of preven  tion as a defense against cancer Part of the reason may be that the only data we have about factors related to cancer are drawn from whole popula  tions These data cannot tell ... its associa tion with the skin cancer on the hand of a lab technician by 1902 Within a decade, many more physicians and scientists, unaware of the dangers of radiation, developed a variety of cancers...

Ngày tải lên: 15/03/2014, 00:20

164 579 1
Báo cáo " Teaching efl writing in Vietnam: Problems and solutions - a discussion from the outlook of applied linguistics " doc

Báo cáo " Teaching efl writing in Vietnam: Problems and solutions - a discussion from the outlook of applied linguistics " doc

... through language use Grabe and Kaplan [5] also emphasize that only teachers who understand theory and make a transition from theory to practice can make the most appropriate decisions for a successful ... in an insightful manner (Bardovi-Harlig, [1]) In the examples, (1) Mary is talking to a man The man is Mary’s father, and (2) The man who Mary is talking to him is her father, we can see that ... first language Many EFL teachers in Vietnam also regard this as a vital reason when analyzing their learners’ errors Nonetheless, as Savignon [15] puts it, the analysis of learners’ errors by means...

Ngày tải lên: 22/03/2014, 10:20

6 704 1
ASSESSMENT OF THE BENEFITS OF EXTENDING THE TROPICAL RAINFALL MEASURING MISSION A PERSPECTIVE FROM THE RESEARCH AND OPERATIONS COMMUNITIES doc

ASSESSMENT OF THE BENEFITS OF EXTENDING THE TROPICAL RAINFALL MEASURING MISSION A PERSPECTIVE FROM THE RESEARCH AND OPERATIONS COMMUNITIES doc

... Ralph J Cicerone is president of the National Academy of Sciences The National Academy of Engineering was established in 1964, under the charter of the National Academy of Sciences, as a parallel ... Another year of TMI data for numerical weather prediction** • Another year of PR and TMI data for enhancing near-real-time rainfall products** • Another year of lightning data for air traffic advisories* ... summarizes the primary operational uses of TRMM data by domestic agencies (at the National Oceanic and Atmospheric Administration [NOAA] and in the Department of Defense) and internationally NOAA’s...

Ngày tải lên: 22/03/2014, 23:20

116 303 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...

Ngày tải lên: 23/03/2014, 13:20

11 680 0
Tài liệu “Measuring customer satisfaction in the context of a project-based organization” docx

Tài liệu “Measuring customer satisfaction in the context of a project-based organization” docx

... and the performance of the organization’s offerings (see e.g Parasuraman et al., 1985 & 1988 & 1991) Another stream of research is the performance-based approach (or linear regression approach) ... important to differentiate whether CSM is focusing on the satisfaction of the customer organization as a whole or the satisfaction of certain individuals within that organization These are clearly ... studies and papers clearly consider CSM as an activity that is based on standardized questionnaires that are delivered to a sample of the customer base These quantitative multi-attribute questionnaires...

Ngày tải lên: 15/01/2014, 15:59

37 1.1K 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... CTGAGGTTACAGACAACTGTTC CCTTTGACATCGCAAGTGGATCA TTGAGGTGACAGACAATTGCCT TCTTTGACTTCTCAAACTGATCG GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC RPE65c-His-Fwd ... GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC GATATCTTATGGTTTGTACATCCCATGGAAAG GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC AAGCTTCTAAGGTTTGTAGATGCCGTGGAG TGGGGAGGACTTTTATGCTGT CTTTTGTGTAGGTGGGATTCG CTGAGGTTACAGACAACTGTTC ... iron-dependent Characterization of the kinetic parameters of the enzymatic activity of zebrafish RPE65c To determine the steady-state kinetics of the enzymatic activity of zebrafish RPE65c, the assay conditions...

Ngày tải lên: 14/02/2014, 14:20

14 754 0
Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc

Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc

... was improved by con˚ sidering only pairs of Ca atoms < 2.5 A apart Because of the different length of a helix A, the Ca atoms N-terminal to or inside helix A are separated by large distances The ... more rapid turnover The kcat ⁄ Km values increase from G1P over PhyK to AppA by a factor of  2200 The conformational changes of AppA upon substrate binding facilitate a faster turnover of phytate ... chain is shown Colors are the same as in Fig 1A indicating the two domains (B) Electrostatic surface potential of the active site of PhyK as calculated with APBS [38] is displayed in a range from...

Ngày tải lên: 16/02/2014, 09:20

13 766 0
Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

... Vaaje-Kolstad et al containing 100 lm of (GlcNAc)14 was analysed at the start, in the middle and at the end of each series of samples The resulting average values of the standards (displaying standard ... instructions, containing ends compatible with the expression vector (forward primer, 5Â-GGTATTGAGGGTCGCCATGGTTATGTTC AATCACCA-3Â; reverse primer, 5Â-AGAGGAGAGTTAG AGCCTTACAAGAAGGGTCCAAAGA-3Â) The PCR product ... regular time intervals The degradation of a- chitin by LlChi1 8A started with a rapid phase, regardless of the presence of LlCBP3 3A In the presence of LlCBP3 3A, the fast initial phase was maintained...

Ngày tải lên: 18/02/2014, 08:20

14 683 0
Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx

Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx

... Proceedings of Fifth Annual Meeting of the North American Chapter of the Association for Computational Linguistics Ravi Sinha and Rada Mihalcea 2007 Unsupervised graph-based word sense disambiguation ... disambiguation In the 12th Conference of the European Chapter of the ACL Satanjeev Banerjee and Ted Pedersen 2003 Extended gloss overlaps as a measure of semantic relatedness In Proceedings of the ... Empirical Methods in Natural Language Processing Weiwei Guo and Mona Diab 2012 Modeling sentences in the latent space In Proceedings of the 50th Annual Meeting of the Association for Computational...

Ngày tải lên: 19/02/2014, 19:20

5 585 0
Tài liệu Báo cáo khoa học: Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. docx

Tài liệu Báo cáo khoa học: Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. docx

... forward SP6-reverse GACTGTTGCTCATTTGTGGA GAGGCTAGATACTGCTCGATGT TGATGATTTGGAACCATTATTGAA CACCTTTTTCCTTCATCTTTTCAT ACTACCTCATGAAGATCCTG TTGCTGATCCACATCTGCTG TAATACGACTCACTATAGGG ATTTAGGTGACACTATAGAA ... cDNA synthesis (ReverTra Dash; Toyobo).Semiquantitative analysis was carried out according to the method described by Laing et al [24] In order to adopt a more semiquantitative approach for analysing ... isolated and characterized a carp cDNA sequence that is homologous to the DNA sequence of mammalian IL-10 Carp IL-10 is 1096 bp in length and encodes a 180 amino acid protein similar to that of...

Ngày tải lên: 20/02/2014, 02:21

8 584 0
Tài liệu Báo cáo khoa học: Characterization and mode of action of an exopolygalacturonase from the hyperthermophilic bacterium Thermotoga maritima doc

Tài liệu Báo cáo khoa học: Characterization and mode of action of an exopolygalacturonase from the hyperthermophilic bacterium Thermotoga maritima doc

... Crystal structure of polygalacturonase from Erwinia carotovora ssp carotovora J Biol Chem 273, 2466024664 Lu CT, Tada T, Nakamura Y, Wada K, Nishimura K, Katsuya Y, Sawada M, Takao M & Sakai T ... Kozianowski G, Canganella F, Rainey FA, Hippe H & Antranikian G (1997) Purication and characterization of thermostable pectate lyases from a newly isolated thermophilic bacterium Thermoanaerobacter ... v) PGA The reaction was started by the addition of an appropriate amount of PelB, and samples were taken at regular time intervals The reaction was stopped by adding 200 lL of the sample to a Somogyi...

Ngày tải lên: 20/02/2014, 03:20

10 592 0
Tài liệu Báo cáo khoa học: Site-directed mutagenesis of a loop at the active site of E1 (a2b2) of the pyruvate dehydrogenase complex A possible common sequence motif docx

Tài liệu Báo cáo khoa học: Site-directed mutagenesis of a loop at the active site of E1 (a2b2) of the pyruvate dehydrogenase complex A possible common sequence motif docx

... reconstituted from E2, E3 and the relevant mutant E1 In all assays, the E1aS283C and E1aF26 6A mutants behaved essentially the same as wild-type E1 In the DCPIP assay, the E1aY28 1A and E1aR28 2A mutants ... displayed a catalytic activity about twice that of wild-type E1 The single mutants E1aR26 7A and E1aD27 6A and the multiple mutants E1aY28 1A/ R28 2A/ S28 3A and E1aY281S/R282S displayed catalytic activities ... Function of the mutated amino acids The E1aY281 and E1aR282 mutants of B stearothermophilus E1 show a higher Vmax in the DCPIP assay, no change in activity in the reductive acetylation assay and a significant...

Ngày tải lên: 20/02/2014, 23:20

10 459 0
Báo cáo " Estimation of emission factors of air pollutants from the road traffic in Ho Chi Minh City " docx

Báo cáo " Estimation of emission factors of air pollutants from the road traffic in Ho Chi Minh City " docx

... the emission factors by road traffic Selection of method for estimating emission factors Based on the analysis of advantages and disadvantages of the currently available methods, it shows that ... concentration during the liberation is well above the typical propane concentration present in the place Several factors are related to the dispersion of pollutants in a street canyon The main factors ... components in the fuel types used; type and age of the engines; circulation conditions of vehicles; topography of the study area Conclusions Based on the advantages and disadvantages of methods...

Ngày tải lên: 05/03/2014, 16:20

9 749 1
Older Persons in Cambodia: A Profile from the 2004 Survey of Elderly pot

Older Persons in Cambodia: A Profile from the 2004 Survey of Elderly pot

... n .a n .a n .a a a a a a a n .a n .a n .a n .a 40.8/31.4 b n .a 72.3/65.0 b n .a 19.6/10.6 b n .a n .a n .a n .a n .a n .a a a a a a a Marital status (% distribution) Men currently married widowed other Women ... a larger share of the SEC sample than of the national population of elderly and, as indicated above, since the literacy level of Phnom Penh elderly is above the national average, this also has ... Village # HHs Chamkaar Mon Chamkaar Mon Chamkaar Mon Doun Penh Doun Penh Prampir Meakkakra Prampir Meakkakra Tuol Kouk Tuol Kouk Daangkao Daangkao Mean Chey Mean Chey Ruessei Kaev Ruessei Kaev...

Ngày tải lên: 05/03/2014, 18:20

82 435 0
w