... var ( x ) Variance operator of variable x ∑ Covariance matrix ∑j Class conditional covariance matrix of class j µ A column vector of mean data µj Mean vector of class (cluster) j Wpca Principal ... was evaluated and compared with other schemes that have been proposed for the same classification problem A normalized database of static facial images of test subjects from a range of cultural ... applications and the availability of low cost CCD cameras and higher computing power, AFER systems have found their way into a number of new emerging areas of applications One area of application...
Ngày tải lên: 16/09/2015, 17:11
... Javad Haddadnia, Majid Ahmadi, Karim Faez, “An Efficient Human Face Recognition System Using Pseudo Zernike Moment Invariant and Radial Basis Function Neural Network, ” International Journal of ... Analysis using Gabor Wavelets,” World Academy of Science, Engineering and Technology 42, 2008 Daw-Tung Lin,”Facial Expression Classification Using PCA and Hierarchical Radial Basis Function Network, ” ... provides such a sufficiently- large network structure that any continuous function can be approximated within an arbitrary degree of accuracy by appropriately choosing radial basis function centers...
Ngày tải lên: 28/04/2014, 10:17
PPt4 Radial Basis Function Network - RBN pps
... Michael F Cohen, and Bobby Bodenheimer 1998 ) Faculty of Electronics NN and Telecommunications, HUT Bangkok, Jun 14 – 23, 2006 38 38 Radial basis function networks Feed-forward networks Non-linear ... ‘nonlocalized’ functions Faculty of Electronics NN and Telecommunications, HUT Bangkok, Jun 14 – 23, 2006 ‘localized’ functions 6 HIDDEN NEURON MODEL Các phần tử Hidden có hàm activation radial basis ... ứng theo khoảng cách Euclidean Hệ số trải/spread: khoảng cách trung bình cu a một tâm đến tất cả các tâm khác Do đó, hệ số trải σ n cu a một hidden neuron n là σn = H ||...
Ngày tải lên: 01/07/2014, 15:20
A radial basis function approach to pricing and hedging options incorporating transaction costs
Ngày tải lên: 26/09/2015, 09:47
báo cáo hóa học: " A radial basis classifier for the automatic detection of aspiration in children with dysphagia" doc
... mitigate saturation of the basis functions The gaussian radial basis function was selected for its proven approximation capabilities The number of radial basis units was increased as necessary during ... vibration signal as an aspiration when a swallow has actually occurred, whereas a false negative (FN) is the event of classifying a vibration signal as a swallow when an aspiration has actually occurred ... Aspiration classifier The proposed feature combinations and radial basis classifier achieved approximately 80% adjusted accuracy in classifying aspirations and swallows This accuracy level already exceeds...
Ngày tải lên: 19/06/2014, 10:20
Báo cáo hóa học: " Research Article Adaptive Processing of Range Scanned Head: Synthesis of Personalized Animated Human Face Representation with Multiple-Level Radial Basis Function" docx
... an average surface data sampling Parts of the anatomical structure are adapted according to the shape transformation function and the others are treated as rigid transformation The dynamic soft ... interpolation Blanz and Vetter [3] create a face shape and texture database A parametric morphable head is interpolated by linear combination of the face model in the database The parameters of the ... the workload of adjusting the physical parameters while applying this physical system onto another models 2.2 Radial basis function A network which is called radial- basis function (RBF) has been...
Ngày tải lên: 22/06/2014, 23:20
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo đồ án trí tuệ nhân tạo: xây dựng chương trình sử dụng Radial basis functions networks để tìm đường phân lớp 2 tập điểm trên không gian
... mangx(j)) * (tinhkhoangcach(mangx(i), mangx(j))))) Next Next nghichdaophi = matran.Inv(mangphi) W = matran.Multiply(nghichdaophi, mangy) TextBox1.Text = "" For i = To sodiem - thapphan = Format$(W(i, ... ma trận trọng số tạo Class Matran: Lưu phương thức ma trận nghịch đảo, nhân Class Toado: Các thuộc tính t a độ điểm bào gồm TdoX TdoY Sau khởi động chương trình đánh dấu điểm huấn luyện canvas ... - khoa CNTT Báo cáo môn trí tuệ nhân tạo Đề tài: xây dựng chương trình sử dụng Radial basis functions networks để tìm đường phân lớp tập điểm không gian Sinh Viên: Nguyễn Minh Tiến – Tin 5a Giáo...
Ngày tải lên: 25/03/2014, 22:19
báo cáo hóa học:" Research Article Design and Implementation of a Single-Frequency Mesh Network Using OpenAirInterface" docx
... channel measurements which can be used for channel characterization and capacity analysis [2] Apart from a general overview of OpenAirInterface, in this paper we present OpenAirMesh a specification ... to transport data traffic corresponding to a particular flow Table 4: Transport and physical channels Each of the transport channels is mapped to a corresponding physical channel of the same name ... equal energy alphabets (such as 16-QAM), it is the minimization problem of a quadratic function again trimming one complex dimension of the system In that case, the real and imaginary parts of...
Ngày tải lên: 21/06/2014, 18:20
Báo cáo toán học: "Strong Insertion of a Contra - Continuous Function" ppt
... cc−property provided that any constant function has property P and provided that the sum of a function with property P and any contra-continuous function also has property P If P1 and P2 are cc−properties, ... definitions and terminology are stated Definition 2.1 Let A be a subset of a topological space (X, τ ) We define the subsets A and AV as follows: A = ∩{O : O ⊇ A, O ∈ τ } and AV = ∪{F : F ⊆ A, F c ... E Lane, Insertion of a continuous function, Pacific J Math 66 (1976) 181–190 S N Maheshwari and R Prasad, On ROs −spaces, Portugal Math 34 (1975) 213–217 H Maki, Generalized Λ−sets and the associated...
Ngày tải lên: 06/08/2014, 05:20
Báo cáo toán học: "The polynomial part of a restricted partition function related to the Frobenius problem" pptx
... formula for PA (t) in [I] Let us define QA (t) by pA (t) = PA (t) + QA (t) From the partial fraction expansion above, it is clear that QA (and hence also pA ) is a quasi-polynomial, that is, an expression ... by PA (t) and call the polynomial part of pA (t) It is easy to see that PA (t) is a polynomial of degree n − (More generally, the degree of PA,λ(t) is one less than the number of values of i ... special case in which the are pairwise relatively prime, each PA,λ(t) for λ = is a constant, and thus QA (t) is a periodic function with average value 0, and this property determines QA (t), and...
Ngày tải lên: 07/08/2014, 06:22
Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country pdf
... Sex (male/female) Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic ... comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic member (in comparison to an assistant ... transfer activities as equal weight for various cases is a simple and optional approach Linear regression analysis was done by entering all variables into the model This type of analysis was...
Ngày tải lên: 11/08/2014, 05:21
báo cáo khoa học: " Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country" pot
... Sex (male/female) Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic ... comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic member (in comparison to an assistant ... transfer activities as equal weight for various cases is a simple and optional approach Linear regression analysis was done by entering all variables into the model This type of analysis was...
Ngày tải lên: 11/08/2014, 16:21
Báo cáo sinh học: " A linear programming approach for estimating the structure of a sparse linear genetic network from transcript profiling data" pdf
... is regulated often by a small number of other genes [3,4] so a reasonable representation of a network is a sparse graph A sparse graph is a graph parametrized by a sparse matrix W, a matrix with ... the class of linear models, the abundance value of a gene is treated as a weighted sum of the abundance values of other genes A high-dimensional transcript profile is a vector of abundance values ... networks Analysis of the statistical and topological properties of learned LP-SLGNs may have practical value; for example, genes with high random walk betweenness, a measure of the centrality of a node...
Ngày tải lên: 12/08/2014, 17:20
Achilles design of a high capacity mesh network with directional antennas
... a 3-D view of radiation patterns Figure 2.1: 3-D representation of antenna radiation pattern of a directional and omnidirectional antenna, courtesy wikipedia.com Antennas are often compared against ... antenna, as well as its directional capabilities The relative gain of an antenna is commonly used In relative gain, the antenna radiation power at a point is compared to that of a isotropic radiator ... 270 A B Antenna gain = 32 dB Figure 2.6: Difference in antenna gain as a result of gain variation in the major lobe Node A and B are tuned, so are A and C However the antenna gain between A and...
Ngày tải lên: 26/09/2015, 10:51
Báo cáo khoa học nhận dạng mặt người dùng polar cosine transform và mạng radial basis function
... BeveRidge, “Recognizing Face with PCA and ICA”, Computer Vision and Image Understanding, pp 115 – 137, 2003 Javad Haddadnia, Majid Ahmadi, Karim Faez, “An efficient feature extraction method with Pseudo-Zernike ... Yang, Sei-ichiro KAMATA, “Fast Polar Harmonic Transforms,” 2010 11th Int Conf Control, Automation, Robotics and Vision, pp.673-677, Singapore, 7-10th December 2010 Yegnanarayana, B (1999),“Artificial ... [10] [11] [12] [13] Wei Jiang, Jian Zhang, Ting-zhi Shen, Xiao-hua Wang, A Novel Facial Features Extraction Algorithm Using Gabor Wavelets”, IEEE Congress on Image and Signal Processing, vol 2,...
Ngày tải lên: 20/12/2015, 05:48
Chapter 2Communicating Over the Network Quangkien@gmail.com.OverviewDescribe the structure of a network, including the devices and media that are necessary for successful communications. Explain the function of protocols in network communications. Ex potx
... be installed – The amount of data and the speed at which it must be transmitted – The cost of the media and installation 17 Local Area Network (LAN) Local Area Network (LAN) An individual network ... Frame Header IP Header Data App TCP Header Header Frame Trailer Data Message: Data Multiple protocols 26 Multiple protocols (encapsulated) HTTP Header Protocols Frame Header IP Header Data App ... Data App TCP Header Header Frame Trailer Data Encapsulation – Process of adding a header to the data or any previous set of headers Decapsulation – Process of removing a header 27 Example: Protocol...
Ngày tải lên: 01/04/2014, 12:20
Báo cáo sinh học: " Research Article Appling a Novel Cost Function to Hopfield Neural Network for Defects Boundaries Detection of Wood Image" pptx
... Signal Processing I0 X-ray I T Figure 1: Attenuation diagram of X-ray imaging law has a single wavelength), when it penetrates a thin part of homogeneous substance which part has a thickness as ... substance, and μ is the attenuation coefficient It is the basic attenuation principle of monochromatic narrow X-ray [14] An attenuation diagram of X-ray imaging law is shown in Figure In the practical ... Laplacian, and Canny We can conveniently implement the traditional image processing methods by some simple commands M-files are macros of Matlab commands that are stored as ordinary text files An...
Ngày tải lên: 21/06/2014, 16:20
Tài liệu Module 1: Introduction to Advanced Administration of a Windows 2000 Network docx
... Centralize Management Delegate Administrative Delegate Administrative Control Control Lead-in As an administrator, you can take advantage of the Windows 2000 Active Directory and Group Policy features ... install software, you can ensure that the same applications are available on any computer to which a user logs on You can also ensure that missing files and settings are repaired automatically ... network are also represented as objects By representing all network resources as objects in a centralized database, Active Directory enables a single administrator to centrally manage and administer...
Ngày tải lên: 17/01/2014, 08:20
Tài liệu Module 8: Concepts of A Network Load Balancing Cluster ppt
... high availability features of a Network Load Balancing cluster C C B B A A Load balance 1/3 each Server B Fails Convergence Load Balance ½ each Lead-in Network Load Balancing manages TCP/IP traffic ... priority Network Load Balancing manages TCP/IP traffic to maintain high availability and dynamic load balancing for IP-based services When a host fails or goes offline, Network Load Balancing automatically ... hosts) An example of an application that does not make changes to a data store is a static Web page that an IIS server supports An example where the application synchronizes data store changes...
Ngày tải lên: 18/01/2014, 05:20