example of a four day 12 component training program

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...

Ngày tải lên: 23/03/2014, 13:20

11 680 0
báo cáo sinh học:" Narrowing the gap between eye care needs and service provision: a model to dynamically regulate the flow of personnel through a multiple entry and exit training programme" pdf

báo cáo sinh học:" Narrowing the gap between eye care needs and service provision: a model to dynamically regulate the flow of personnel through a multiple entry and exit training programme" pdf

... synthesis of a large number of small units of activity and how each relates to Leave Training St a g e Training Ex i s t i n g W/F Upgraded St a g e Training St a g e Training St a g e Training ... A3 A3 A3 A3 A2 A2 A2 A2 A1 Eye Car e Tr aining Modules H2 A1 A1 A1 Eye car e nur se Catar act sur geon Optometr ist Ophthalmologist Figure Example1 of the use of a proposed modular training system ... n g W/F Upgraded St a g e Training Re f r a c t ionist L e a v e Ey e Ca r e W/F Figure for Options3 graduates of Stage1 training Options for graduates of Stage1 training Page of (page number...

Ngày tải lên: 18/06/2014, 17:20

6 442 0
báo cáo hóa học: " A randomised comparison of a four- and a five-point scale version of the Norwegian Function Assessment Scale" doc

báo cáo hóa học: " A randomised comparison of a four- and a five-point scale version of the Norwegian Function Assessment Scale" doc

... Table 3: Mean item-total correlation and Cronbach's alpha for domain scores in the NFAS-4 and the NFAS-5 (N = 3325) Cronbach's alphaa NFAS-4 NFAS-5 Mean item-total correlation NFAS-4 NFAS-5 Walking/standing ... seven all-point defined scales are used Seven categories are also harder to fit across a page of A4 with a reasonably sized typeface However, if the number of alternatives is less than the rater's ... Mann Whitney U-test Data quality The response rates and the low levels of missing data show that both versions of the NFAS are acceptable to the population A few items had a high percentage of...

Ngày tải lên: 18/06/2014, 22:20

9 489 0
Báo cáo hóa học: " Research Article On the Monotonicity and Log-Convexity of a Four-Parameter Homogeneous Mean" potx

Báo cáo hóa học: " Research Article On the Monotonicity and Log-Convexity of a Four-Parameter Homogeneous Mean" potx

... in Pure and Applied Mathematics, vol 4, no 4, article 80, pages, 2003 17 E Neuman, A generalization of an inequality of Jia and Cau,” Journal of Inequalities in Pure and Applied Mathematics, ... Journal of Mathematical Analysis and Applications, vol 92, no 1, pp 207–223, 1983 Zs P´ les, “Inequalities for differences of powers,” Journal of Mathematical Analysis and Applications, a vol 131, ... “Inequalities involving Stolarsky and Gini means,” Mathematica Pannonica, a vol 14, no 1, pp 29–44, 2003 16 G Jia and J Cao, A new upper bound of the logarithmic mean,” Journal of Inequalities...

Ngày tải lên: 22/06/2014, 02:20

12 301 0
Anatomy of a Robot Part 12 pptx

Anatomy of a Robot Part 12 pptx

... is already available, but the data rate does not match the rate needed in a specific application A specific example might be a digital video signal coming in at a full broadcast rate At 270 million ... low-pass filter, the calculations are simpler The gain is flat at a value of and then drops off completely (in the ideal math equation) Taking advantage of the simplified filter shape, and with a ... data in an organized way DSP can be accomplished in hardware FieldProgrammable Gate Array (FPGAs) or the processing can be done in software Even a general-purpose computer can perform DSP calculations...

Ngày tải lên: 10/08/2014, 01:22

20 301 0
Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country pdf

Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country pdf

... Sex (male/female) Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic ... comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic member (in comparison to an assistant ... transfer activities as equal weight for various cases is a simple and optional approach Linear regression analysis was done by entering all variables into the model This type of analysis was...

Ngày tải lên: 11/08/2014, 05:21

8 341 0
Báo cáo y học: " A randomized controlled pilot study of a brief web-based mindfulness training" docx

Báo cáo y học: " A randomized controlled pilot study of a brief web-based mindfulness training" docx

... training The training always started on a Monday to ensure, that all participants would have equal conditions regarding weekdays The training duration was 13 days and consisted of two modules Each module ... contact us via a contact-form on the homepage for technical assistance Beyond that the training was self-guided without personal contact The training consisted of audio files, a flash animated ... most measures under ITT, feasibility of such a program was demonstrated and also that persons continued to use techniques of the training in daily life Trial Registration German Clinical Trials...

Ngày tải lên: 11/08/2014, 16:20

40 312 0
báo cáo khoa học: " Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country" pot

báo cáo khoa học: " Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country" pot

... Sex (male/female) Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic ... comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic member (in comparison to an assistant ... transfer activities as equal weight for various cases is a simple and optional approach Linear regression analysis was done by entering all variables into the model This type of analysis was...

Ngày tải lên: 11/08/2014, 16:21

8 315 0
Báo cáo y học: " The Farsi version of the Hypomania Check-List 32 (HCL-32): Applicability and indication of a four-factorial solution" ppt

Báo cáo y học: " The Farsi version of the Hypomania Check-List 32 (HCL-32): Applicability and indication of a four-factorial solution" ppt

... Disord 12 Mohammadi MR, Davidian H, Noorbala AA, Malekafzali H, Naghavi HR, Pouretemad HR, Yazdi SA, Rahgozar M, Alaghebandrad J, Amini H, Razzaghi EM, Mesgarpour B, Soori H, Mohammadi M, Ghanizadeh ... disorder Arch Iranian Medicine 2009, 12: 41-47 15 American Psychiatric Association (APA): Diagnostic and Statistical Manual of Mental Disorders Washington, DC: American Psychiatric Association; ... University of Medical Sciences, Tehran, and the Research Center for Behavioural Disorders and Substance Abuse of Hamadan University of Medical Sciences, Hamadan The study was approved by the Hamadan...

Ngày tải lên: 11/08/2014, 16:23

6 253 0
Identification, characterization and expression analysis of a novel TPA (12 0 tetradecanoylphorbol 13 acetate) induced gene

Identification, characterization and expression analysis of a novel TPA (12 0 tetradecanoylphorbol 13 acetate) induced gene

... that the activation of telomerase is a late event (58-60) BRCA2 Inherited BRCA2 mutations are typically associated with familial breast and ovarian cancer syndrome, but also carry a significant ... Researchers are thus cautious about the accuracy of microarray data, but most studies place the blame on inadequate bioinformatical and statistical tools for ‘data mining’ (111, 112) , rather than ... epidemiological and genetic studies Pancreatic adenocarcinoma is a disease that is associated with advancing age (12) It is rare before the age of 40, and culminates in a 40 fold increased risk by the age...

Ngày tải lên: 14/09/2015, 22:09

118 501 0
Molecular analysis of the role of a yeast potassium transport component TRK1 in agrobacterium mediated transformation

Molecular analysis of the role of a yeast potassium transport component TRK1 in agrobacterium mediated transformation

... Trk1-Seq-F1 ACAAAGACAGCACCAACAGA Trk1-Seq-R1 GAAGTAGTGAACCGCGATAA Trk1-Seq-F2 TGGATCGTGCAATTATCTTG Trk1-Seq-R2 AAGGCGATTAAGTTGGGTAA 26 2.2 DNA manipulation 2.2.1 Transformation of plasmid DNA into ... seelection marrker 25 Table 2.5: List of primers Primer Sequence (5’-3’) GFP1 GATAAGGCAGATTGAGTGGA GFP2 AAAGATGACGGTAACTACAA TO105-2F CTAGGGATCCGCCACCATGCATTTTAGAAGAACGAT TO105-2R CTAGGGATCCCGTTAGAGCGTTGTGCTGCTCC ... the plant model organism Arabidopsis thaliana Recently, it was shown that AtKu80, an A thaliana homologue of the yeast Yku80p, can directly interact with a double-strand intermediate of T-DNA in...

Ngày tải lên: 16/10/2015, 11:57

109 382 0
DEVELOPMENT OF a BLUEPRINT FOR COMPUTER BASED TRAINING (CBT) IN THE USE OF ELECTRONIC CHART DISPLAY AND INFORMATION SYSTEMS (ECDIS)

DEVELOPMENT OF a BLUEPRINT FOR COMPUTER BASED TRAINING (CBT) IN THE USE OF ELECTRONIC CHART DISPLAY AND INFORMATION SYSTEMS (ECDIS)

... ensure appropriate selection EXPLAIN ALL SAFETY-RELEVANT AS WELL AS OTHER MAJOR CHARACTERISTICS OF ECDIS DATA SUCH AS DATA CONTENTS, HANDLE ECDIS DATA ON BOARD AND ASSESS ALL ERRORS, INACCURACIES AND ... of and ability to use navigational charts and publications, …” Criteria for evaluating competency are stated as “The charts selected are the largest scale suitable for the area of navigation and ... data”, presentation-independence of data, ENC and SENC 3.2 DATA STRUCTURE AND DATABASE: Explain - the data structure and databases of ECDIS, including objects and their attributes (object catalogue)...

Ngày tải lên: 09/05/2016, 16:54

62 405 1
Tài liệu Effect of a school-based oral health education programme in Wuhan City, Peoples Republic of China ppt

Tài liệu Effect of a school-based oral health education programme in Wuhan City, Peoples Republic of China ppt

... calibrated against a master examiner The kappa statistic was used to assess the inter-examiner reliability of caries and the final kappa scores were higher than 0.8518 Data on oral health behaviour of ... fluoride toothpaste Milk with sugar at least once a day Sugary drinks at least once a day Cakes/biscuits at least once a day Sweets/chocolate at least once a day Table 31.3 34.4 73.1 29.0 6.3 15.4 ... Petersen et al.: School -based oral health education programme in Wuhan City 36 Data analysis All data sheets were transferred to the University of Copenhagen and analysed by means of the SPSS...

Ngày tải lên: 14/02/2014, 13:20

9 587 0
báo cáo hóa học: " Development and evaluation of a computer-based medical work assessment programme" pdf

báo cáo hóa học: " Development and evaluation of a computer-based medical work assessment programme" pdf

... 2: Main and second activities Status CA1 CA MA1, SA MA, SA1 MA, SA MA, SA MA, SA Event +CA2 +SA +MA2 + SA2 +CA -SA -MA Result CA1 stop CA2 start CA → MA SA start MA1 stop MA2 start SA1 stop SA2 ... complete, data from each case is transferred to a PC and evaluated statistically and graphically: the number of individual occurrences of each task, mean duration of each occurrence of each task, the ... start MA stop SA stop CA start SA stop MA → CA MA stop SA stop SA → CA CA start CA = Central Activity (no second activity) MA = Main Activity SA = Second Activity Reliability study Five trained...

Ngày tải lên: 20/06/2014, 00:20

5 381 0
Báo cáo y học: " Assessing the efficacy of a modified assertive community-based treatment programme in a developing country" potx

Báo cáo y học: " Assessing the efficacy of a modified assertive community-based treatment programme in a developing country" potx

... Statistical Analysis All data were entered into a single, electronic database Statistical Analysis was done with Statistica version software (Statsoft, Inc 2009) As some of the data was descriptive ... mixed African-Caucasian ancestry Black refers to black African participants **Participants who live within the city limits of the City of Cape Town ***Participants who are employed on a part-time ... Saude Publica 2000, 34:280-285 12 Lazarus R: Managing de-institutionalization in a context of change: The case of Gauteng, South Africa S Afr Psychiatry Rev 2005;8:65-69 South African Psychiatry...

Ngày tải lên: 11/08/2014, 16:22

8 310 0
Báo cáo y học: "Non-pharmaceutical prevention of hip fractures – a cost-effectiveness analysis of a community-based elderly safety promotion program in Sweden" doc

Báo cáo y học: "Non-pharmaceutical prevention of hip fractures – a cost-effectiveness analysis of a community-based elderly safety promotion program in Sweden" doc

... risk that mere chance affects the estimates The effect evaluation data was however analysed in a longitudinal analysis, that seeks to take account of both within-area, between-area and population-group ... parameters are altered in univariate and multivariate analyses based on alternative data sources (details are found in [18]) The overall model uncertainty is investigated in a bootstrap analysis based ... Swedish data is used The model data is mainly taken from secondary data sources, while the program data is taken from an implemented program, and is Page of 12 (page number not for citation purposes)...

Ngày tải lên: 13/08/2014, 11:22

12 213 0
w