example of a cover letter for college student

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC JH3.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC JH4-5.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC JH6.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCGTGGTCCC L. ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC VK4.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC VK5.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC VK6.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC VL1.link ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCTTCTGAGCTGACTCAGGACCC VL 3a. link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCCTATGTGCTGACTCAGCCACC VL4.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCACGTTATACTGACTCAACCGCC VL5.link...

Ngày tải lên: 23/03/2014, 13:20

11 680 0
Layout of a formal letter

Layout of a formal letter

... organising it in a clear and logical manner rather than expanding too much. Last Paragraph The last paragraph of a formal letter should state what action you expect the recipient to take- ... to inform you …… Layout of a Formal Letter The example letter below shows you a general layout for a formal letter. Pass your mouse over the different areas of it to find out more information ... please reply Outline: A Covering Letter A covering letter is the one that accompanies your CV when you are applying for a job. Here is a fairly conventional plan for the layout of the paragraphs. Opening...

Ngày tải lên: 01/08/2013, 05:42

7 637 1
Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt

Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt

... cttggggcct ctaaacgggt cttgaggggt 360 361 TTTTTGCTGA AAGGAGGAAC TATATCCGGA TATCCCGCAA 400 401 GAGCCCGGCA GTACCGGCAT AACCAAGCCT ATGCCTACAG 440 441 CATCCAGGGT TTG GACGGTGCCG AGGATGACGA TGAAGCGCCA 480 ... 41 ttattatggg tattacttta tctgatgatt ctgaTcatca 80 81 Gtttttgctt ggatcccagg ttgttgtaca gaatgctggt 120 121 catatgagcg gcagcgatgg cggcgtgtgc cgaaaattct 160 161 gaaaaaatgc cgccgcgata gcgattgccc ... gggcgcgtca 200 201 tttgccgcgg caacggctat tgcggctaac tcgagcccgg 240 241 gtgactgcag gaaggggatc cggctgctaa caaagcccga 280 281 aaggaagctg agttggctgc tgccaccgct gagcaataac 320 321 tagcataccc cttggggcct...

Ngày tải lên: 12/02/2014, 10:20

9 497 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... 5Â-CTC GAGATGGATAAAGTTTTAAACAGAG-3Â and LTA- 1R, 5Â-TGAAGGCAAATCTCTGGAC-3Â for the former, and LTAM2F, 5Â-CAGCTGTTTTGCTTGAATTATG-3Â and LTA2R, 5Â-GAATTCATTATGTTTCAGGTTCA GGGG-3Â for the latter. The ... long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura, Nobuaki Yoshida and ... vessel endothelial hyaluronan receptor-1; MACS, magnetic-activated cell separation; MAPK, mitogen-activated protein kinase; PFA, paraformaldehyde; Prox-1, prospero-related homeobox-1; SV40T Ag, SV40 large...

Ngày tải lên: 18/02/2014, 17:20

11 873 0
An Investigation into the Implementation of a Brewpub at the New Student Union Building docx

An Investigation into the Implementation of a Brewpub at the New Student Union Building docx

... facilities. For example, a graduate student in Applied Biology researching brewery wastewater treatment would have access to data regarding wastewater output of a typical brewpub. He/she could also ... positively as well as reducing disposal costs. Another alternative for wastewater treatment is to transport the waste water to the Iona Island Sewage Treatment facility via the Greater Vancouver ... SteamWorks Brewing Company, a brewpub located at Waterfront. At SteamWorks, we asked how they dealt with waste grains, and found out that waste grains can be used for plant fertilizers and animal...

Ngày tải lên: 08/03/2014, 23:20

23 482 0
Báo cáo "Development of a software package for 3D structured mesh generation " pdf

Báo cáo "Development of a software package for 3D structured mesh generation " pdf

... interface of the package The package is designed with a main interface that allows users to input topographical elevation data of the top (upper) surface of any 3D objects in the form of digitized ... viewing and presenting the topographic data and the generated meshes. The package has been applied to the generation of 3D computational meshes used as the input of a computational fluid dynamics ... equation (1) is just an one to one inverse mapping between the 3D real computational domain and a rectangular domain in the parametric space [1, 2, 5, 6]. For short, the formulae for Y and...

Ngày tải lên: 14/03/2014, 13:20

14 402 0
Báo cáo khoa học: "Automatic Induction of a CCG Grammar for Turkish" pptx

Báo cáo khoa học: "Automatic Induction of a CCG Grammar for Turkish" pptx

... Hockenmaier. 2003. Data Models for statisti- cal parsing with Combinatory Categorial Grammar. Ph.D. thesis, University of Edinburgh. Beryl Hoffman. 1995. The Computational Analysis of the Syntax and ... boost the performances of statistical parsers from small amounts of human labeled data. Generalisation of this lexicon using the formalism in Baldridge (2002) would result in a more compact lexicon, ... emphasize that the predicate is intransitive and it may have a locative adjunct. Similarly, a T.OBJECT link is added from “kitap” to “okudu˘gum”. Similar labels were added to the treebank manually...

Ngày tải lên: 17/03/2014, 06:20

6 373 0
Báo cáo khoa học: "PEAS, the first instantiation of a comparative framework for evaluating parsers of French" potx

Báo cáo khoa học: "PEAS, the first instantiation of a comparative framework for evaluating parsers of French" potx

... Annotation formalism The definition of the annotation formalism is the core element of the evaluation process. Indeed, the formalism must have a coverage of syntactical phenomena as broad as possible ... France {gendner,gabrieli,jardino,monceaux,pap,isabelle,anne}@limsi.fr Abstract This paper presents PEAS, the first comparative evaluation framework for parsers of French whose annotation formalism allows the annotation of both constituents and functional relations. ... Therefore, the need for a complete comparative evaluation framework — including a pivot annotation formalism, a reference treebank, evaluation metrics and the associated software — is increasing. It is...

Ngày tải lên: 17/03/2014, 22:20

4 323 0
Báo cáo khoa học: Inhibition of a-synuclein fibrillization by dopamine analogs via reaction with the amino groups of a-synuclein Implication for dopaminergic neurodegeneration pot

Báo cáo khoa học: Inhibition of a-synuclein fibrillization by dopamine analogs via reaction with the amino groups of a-synuclein Implication for dopaminergic neurodegeneration pot

... reactions of DA analogs with a- Syn and some amino acids. (A) UV-vis spectra of a- Syn with DA, CA, HQ and Q after reaction for 24 h. The a- Syn alone sample was as a control. The concentration of a- Syn ... MTT reduction ability of the cell culture after addition of a- Syn or DA was also measured as a comparison. The concentration of all a- Syn forms for the MTT assay was 10 l M. Data represented are mean ± ... Biological Sciences, Chinese Academy of Sciences, Shanghai, China 2 Shanghai Institute of Materia Medica, Shanghai, China 3 Shanghai Institute of Nuclear Research, Shanghai, China 4 Bio-X Research...

Ngày tải lên: 23/03/2014, 15:20

12 415 0
Báo cáo khoa học: "The Design of a Computer Language for Linguistic Information" ppt

Báo cáo khoa học: "The Design of a Computer Language for Linguistic Information" ppt

... International and Center for the Study of Language and Information Stanford University Abstract A considerable body of accumulated knowledge about the design of languages for communicating ... structs Clearly, the bare PATR-II formalism, as it was pre- sented in Section 2.1, is sorely inadequate for any major attempt at building natural-language grammars because of its verbosity and redundancy. ... Denotational Semantics One reason for maintaining the simplicity of the bare PATR-II formalism is to permit a clean semantics for the language. We have provided a denotational semantics for PATR-ll...

Ngày tải lên: 24/03/2014, 01:21

5 383 0
Evaluation of a diagnostic algorithm for smear-negative pulmonary tuberculosis in HIV-infected adults doc

Evaluation of a diagnostic algorithm for smear-negative pulmonary tuberculosis in HIV-infected adults doc

... DipHIVMan (SA) Objectives. To evaluate the diagnostic accuracy of and reduction in diagnostic delay attributable to a clinical algorithm used for the diagnosis of smear-negative pulmonary tuberculosis ... sputum smear, 15 these are unavailable in most primary care settings in South Africa. It is often necessary to make a clinico-radiological diagnosis of smear-negative TB (SNTB) using an algorithm ... radiograph; ADA = adenosine deaminase; CRP = C-reactive protein; Hb = haemoglobin. 5 probable TB ‡ cases (3 had military patterns on CXR, and 2 had high ADA levels in pleural effusion, all...

Ngày tải lên: 29/03/2014, 03:20

7 366 0
Báo cáo hóa học: " Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R in whole blood" pptx

Báo cáo hóa học: " Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R in whole blood" pptx

... required upon hand-off for assay validation. SJ, AW, SWA and KA performed the in vitro assays on mon- keys treated with Ab-01 and control Ig and analyzed the data, and KA and SA performed the experiments ... housed and cared for according to the American Association for Accreditation of Laboratory Animal Care guidelines. The Wyeth Institutional Animal Arai et al. Journal of Translational Medicine 2010, ... Cambridge Park Drive,Cambridge, MA 02140, USA Full list of author information is available at the end of the article Arai et al. Journal of Translational Medicine 2010, 8:51 http://www.translational-medicine.com/content/8/1/51 Page...

Ngày tải lên: 18/06/2014, 16:20

13 529 0
Báo cáo hóa học: " Development of a mathematical model for predicting electrically elicited quadriceps femoris muscle forces during isovelocity knee joint motion" potx

Báo cáo hóa học: " Development of a mathematical model for predicting electrically elicited quadriceps femoris muscle forces during isovelocity knee joint motion" potx

... University of Delaware, Newark, DE, USA and 2 Department of Mechanical and Aeronautical Engineering, Civil and Environmental Engineering, and Land, Air, and Water Resources, University of California, ... dominated by parameters A 40 and τ 2 (Fig. 6). For example, at a short- ening speed of 200°/s parameters A 40 and τ 2 account for ~25% and ~56% of the output variance, respectively. In addition, ... pattern that produced the maximum force-time integrals and the maximum peak forces (Fig 8). For example, at -25°/s the maximum force-time integral for both predicted and measured data occurred at an...

Ngày tải lên: 19/06/2014, 08:20

20 467 0
báo cáo hóa học: " Rehabilitation robotics: pilot trial of a spatial extension for MIT-Manus" pdf

báo cáo hóa học: " Rehabilitation robotics: pilot trial of a spatial extension for MIT-Manus" pdf

... than using robotics as an assistive technology for a disabled individual, our research focus is on the develop- ment and application of robotics as a therapy aid, and in particular a tool for ... stan- dalone fashion or integrated to the planar MIT-MANUS to allow spatial movements. Note that in the standalone fashion it can be operated at any angle to the horizontal and vertical planes with adjustable ... commercial version of MIT's module can be operated in stan- dalone fashion or integrated to the planar MIT-MANUS to allow spatial movements. Note that in the standalone fashion it can be operated...

Ngày tải lên: 19/06/2014, 10:20

15 298 0
Báo cáo hóa học: " Strong convergence of a hybrid method for monotone variational inequalities and fixed point problems" ppt

Báo cáo hóa học: " Strong convergence of a hybrid method for monotone variational inequalities and fixed point problems" ppt

... variational inequality is denoted by Ω. Variational inequality theory has emergedasanimportanttoolinstudyingawide class of obstacle, unilateral and equilibrium problems, which arise in several ... literature for solving a more general problem that consists of finding a co mmon point that lies in the solution set of a variational inequality and the set of fixed points of a nonexpansive mapping. ... and variational inequalities. J Inequal Appl 2009, 13 (2009). Article ID 208692 20. Cianciaruso, F, Colao, V, Muglia, L, Xu, HK: On an implicit hierarchical fixed point approach to variational inequalities. Bull...

Ngày tải lên: 20/06/2014, 22:20

10 425 0
w