example of a consumer helper class
Báo cáo khoa học: Crystal structure of a cold-adapted class C b-lactamase potx
Ngày tải lên :
23/03/2014, 07:20
... Psychrophilic class C b-lactamase C Michaux et al classes A, C and D are active site serine enzymes, whereas class B b-lactamases require one or two zinc ions for their activity [1] Only class C b-lactamases ... Glu272–Arg148 21 19 14 092 8248 5844 –1 6.5 No of hydrogen bonds (side chain–side chain) Aromatic stacking ˚ ASA total (A2 ) ˚ ASA apolar (A2 ) ˚ ASA polar (A2 ) Formal global charge Theoretical pIb ... activity: crystallographic structure at 2 -A resolution of cephalosporinase from the ampC gene of Enterobacter cloacae P99 and comparison with a class A penicillinase Proc Natl Acad Sci USA 90, 11257–11261...
- 11
- 341
- 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
Ngày tải lên :
23/03/2014, 13:20
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
- 11
- 679
- 0
Outline môn Tiếng Anh - What are the good and bad points of advertising from the view point of a consumer?
Ngày tải lên :
02/06/2014, 15:10
... because their products advertised many times a day and many different channels In addition to payment for famous stars LEAFLET STRENGTHS Advertising leaflets will help your company can provide ... servicebe advertised? Briefly present the strengths and weaknesses of each means A product or a service can be advertised by many means such as: Television, Newspaper, Leaflet… TELEVISION, LEAFLET, ... adults but also children CHEATING like they will all be Advertising usually makes products look fantastic deals but the reality is not EXPENSIVE Advertising increases cost of product so the consumers...
- 20
- 862
- 0
Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country pdf
Ngày tải lên :
11/08/2014, 05:21
... Sex (male/female) Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic ... comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic member (in comparison to an assistant ... transfer activities as equal weight for various cases is a simple and optional approach Linear regression analysis was done by entering all variables into the model This type of analysis was...
- 8
- 341
- 0
báo cáo khoa học: " Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country" pot
Ngày tải lên :
11/08/2014, 16:21
... Sex (male/female) Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic ... comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic member (in comparison to an assistant ... transfer activities as equal weight for various cases is a simple and optional approach Linear regression analysis was done by entering all variables into the model This type of analysis was...
- 8
- 315
- 0
Development of a method to measure consumer emotions associated with foods
Ngày tải lên :
03/04/2013, 21:07
... included approximately equal percentages of males and females, and the age range was from 18 to 65 years of age Basically consumers are screened and recruited via internet and/or phone based on ... chocolate, vanilla ice cream, fried chicken and mashed potatoes and gravy Pizza and chocolate produced the strongest emotions based on Analysis of Variance The terms active, adventurous, affectionate, ... so consumers can get acquainted with the ballot more quickly and shorten the task over each sample evaluation We compared this alphabetized approach with a randomized attribute presentation and...
- 10
- 781
- 3
Features of a .NET Class
Ngày tải lên :
05/10/2013, 07:20
... in a class that has these properties or events In a class with a property named P, the names get_P and set_P are reserved, and in a class with an event named E, add_E, remove_E, and raise_E are ... has a signature that is determined by the delegate declaration BeginInvoke has the same parameters as the usual Invoke function, plus two additional parameters: the first is an AsyncCallback class ... setting the AtomicNumber property to the class and its derived classes That way the radioactive atom can change the atomic number to process a decay event, but consumers of the atom class can’t otherwise...
- 38
- 298
- 0
Báo cáo khoa học: Effects of a novel arginine methyltransferase inhibitor on T-helper cell cytokine production pot
Ngày tải lên :
06/03/2014, 11:20
... [pii] Purandare AV, Chen Z, Huynh T, Pang S, Geng J, Vaccaro W, Poss MA, Oconnell J, Nowak K & Jayaraman L (2008) Pyrazole inhibitors of coactivator associated arginine methyltransferase (CARM1) ... PRMT reaction, the use of SAM analogs is a logical strategy for the direct inhibition of PRMTs As a SAM analog, sinefungin can compete for SAM binding and inhibit the activity of all SAM-dependent ... Bonham et al 11 Clarke SG (2006) Inhibition of mammalian protein methyltransferases by 5¢-methylthioadenosine (MTA): a mechanism of action of dietary SAMe? In The Enzymes: Protein Methyltransferases...
- 13
- 646
- 0
Báo cáo khoa học: Phaiodotoxin, a novel structural class of insect-toxin isolated from the venom of the Mexican scorpion Anuroctonus phaiodactylus pdf
Ngày tải lên :
07/03/2014, 16:20
... (5¢-gcugauggcgaugaaugaacacugcguuugCUGG CUUUGAUGAAA-3¢) using T4 DNA ligase The modified cDNA was used as template for PCR amplification Two rounds of amplification with the primers from the Ambion ... mV) of lM phaiodotoxin Data are presented as a Boltzmann sigmoidal fit Each point represents the mean ± SEM of data from five experiments (C) Superimposed graphics of the activation and steady-state ... is caused by a partial impairment of inactivation or shifted voltage dependence Moreover, Cannon [39] showed that even a subtle disruption of inactivation (on average, about 2% of channels fail...
- 9
- 533
- 0
Báo cáo khoa học: "A Chain-starting Classifier of Definite NPs in Spanish" docx
Ngày tải lên :
08/03/2014, 21:20
... corpus of AnCora – Annotated Corpora for Spanish and Catalan (Taule et al., 2008), developed at the University of Barcelona and freely available from http: //clic.ub.edu/ancora AnCora-Es is a half-million-word ... a complex definite), classify as chain starting item Since such neuters have a low coreferential capacity, the classification of these NPs as chain starting can favour recall Chain-starting Classifier ... storage units, classify as chain starting (b) and the head of m is AP-preference, classify as chain starting (c) and m is an NE, classify as chain starting (d) Otherwise, classify as coreferent...
- 8
- 322
- 0
Đề tài " The diameter of the isomorphism class of a Banach space " pdf
Ngày tải lên :
15/03/2014, 09:20
... Tzafriri, Classical Banach Spaces I Sequence Spaces, -index of a Banach space, Israel J Springer-Verlag New York (1977) [Mc] R A McGuigan, Jr., Near isometry of Banach spaces and the Banach-Mazur ... ISOMORPHISM CLASS OF A BANACH SPACE 435 Problem 10 If X is a separable, infinite dimensional Banach space and there is a K so that every isomorph of X is Lipschitz K-elastic, must X contain a subspace ... constant + ε Proof Since C[0, 1] has a basis, the lemma follows from Lemma and the the classical fact that every separable Banach space 1-embeds into C[0, 1] Lemma is false for some nonseparable...
- 16
- 376
- 0
Báo cáo khoa học: Purification and cloning of a Delta class glutathione S-transferase displaying high peroxidase activity isolated from the German cockroach Blattella germanica pptx
Ngày tải lên :
23/03/2014, 09:21
... Nilaparvata lugens Lucilia cuprina Anopheles dirus Bombyx mori Manduca sexta Anopheles gambiae Anopheles gambiae Blattella germanica Drosophila melanogaster Manduca sexta Anopheles gambiae Anopheles ... Udomsinprasert R, Pongjaroenkit S, Wongsantichon J, Oakley AJ, Prapanthadara L -A, Wilce MCJ & Ketterman AJ (2005) Identification, characterization and structure of a new Delta class glutathione transferase ... presence of at least six classes of cytosolic GSTs in insects [2] The majority of GSTs are in the Delta and Epsilon classes, and the remaining enzymes are in the Omega, Sigma, Theta and Zeta classes...
- 11
- 426
- 0
Báo cáo khoa học: " Development and Use of a Gold-Standard DataSet for Subjectivity Classifications" pdf
Ngày tải lên :
23/03/2014, 19:20
... of manual tagging Natural Language Engineering J Carletta 1996 Assessing agreement on classification tasks: The kappa statistic Computational Linguistics, 22(2):249-254 W Chafe 1986 Evidentiality ... Stutz 1996 Bayesian classification (AutoClass): Theory and results In Fayyad, Piatetsky-Shapiro, Smyth, and Uthurusamy, editors, Advances in Knowledge Discovery and Data Mining AAAI Press/MIT ... including AutoClass (Cheeseman and Stutz, 1996) The form of the latent class model is that of naive Bayes: the observed variables are all conditionally independent of one another, given the value of...
- 8
- 354
- 0
Báo cáo khoa học: Creating hybrid proteins by insertion of exogenous peptides into permissive sites of a class A b-lactamase doc
Ngày tải lên :
30/03/2014, 02:20
... all class A b-lactamases, TEM-1 folds into a structure formed by an a ⁄ b-domain and an all -a- domain (Fig 1A) At the junction between the two domains, a groove harboring the active site is partially ... C, Frere JM & Waley SG (1987) Automated analysis of enzyme inactivation phenomena Application to beta-lactamases and DD-peptidases Biochem Pharmacol 36, 2393–2403 23 Giannella RA (1976) Suckling ... Purification and characterization of heat-stable enterotoxin produced by a strain of E coli pathogenic for man J Biol Chem 255, 4716–4721 28 Bush K, Jacoby GA & Medeiros AA (1995) A functional classification...
- 11
- 358
- 0
Assessment Of The Comparative Advantage Of Various Consumer Goods Produced In India Vis-à-vis Their Chinese Counterparts pptx
Ngày tải lên :
30/03/2014, 06:20
... shortage of technical talent in this area INDIA • • • • INDIA • India has abundant technical talent in the software domain A large number of players like Nokia, Kyocera, Motorola etc have their software ... China is almost 100% in urban areas and around 50% in rural areas Typically water is abundantly available in southern and eastern areas while the western and northern regions of China are water ... assess the comparative advantage of manufacturing consumer durables across six product categories in India and China The study encompasses analysis of macroeconomic and production specific factors...
- 182
- 392
- 0
folsom new archaeological investigations of a classic paleoindian bison kill jun 2006
Ngày tải lên :
11/06/2014, 14:22
... in an assemblage of fluted points, and about the cause(s) of that variation (Amick 199 9a; Boldurian and Cotter 1999; Ingbar 1992; Ingbar and Hofman 1999; Hofman 199 9a, 1999b; see also Hawkes and ... seasons at Folsom and which provides a first-hand and almost-daily account of the excavations In appendix C, Donald Dorward and I take an archaeological look at the Colorado (1926–1927) and American ... Roberts, archaeologist at the Bureau of American Ethnology, Smithsonian Institution; and A V Kidder of the Carnegie Institution of Washington and the leading American archaeologist of his day All agreed...
- 389
- 227
- 0
báo cáo hóa học: " Development and validation of the Brazilian version of the Attitudes to Aging Questionnaire (AAQ): An example of merging classical psychometric theory and the Rasch measurement model" pptx
Ngày tải lên :
18/06/2014, 22:20
... reliability analyses Exploratory and Confirmatory Factor analysis were performed to assess whether the Brazilian data fit the international pooled model Finally, an IRT approach, in particular, that of ... differential item functioning The present paper aims to illustrate the potential combination of classical psychometric theory and Rasch Analysis in the validation of the AAQ instrument in a Brazilian ... together in a complementary way While the traditional approach provides relevant information regarding discriminant validity, missing values distributions and factor analyses loading, Rasch analysis...
- 10
- 871
- 0
Báo cáo sinh học: " A new example of viral intein in Mimivirus" ppt
Ngày tải lên :
18/06/2014, 22:20
... DNA polymerase II (PolII), bacterial DNA polymerase III α subunit (DnaE) and bacteriophage DNA polymerase I Among these, archaeal PolI belongs to the family B DNA polymerase Archaeal PolI contains ... KFVKPVSLEFEKVYYPYLLI -AEAMALGREAADWVSG HFPSPIRLEFEKVYFPYLLI -MKTIAKCQRAAKLINQ NVPKPQSIVYEKTLHPFILV - : : :: Sequence alignment of Family B DNA polymerases from the Archaea, Bacteria and Eukarya domains ... 7-missmaches (TATATTGAC/ACTGATGGA; MJ0885) and mismatches (TATATAGAC/ACGGATGGA; PH1947), respectively To the best of our knowledge, no evidence has been reported for a homing endonuclease recognizing...
- 7
- 435
- 0
báo cáo hóa học: " A radial basis classifier for the automatic detection of aspiration in children with dysphagia" doc
Ngày tải lên :
19/06/2014, 10:20
... vibration signal as an aspiration when a swallow has actually occurred, whereas a false negative (FN) is the event of classifying a vibration signal as a swallow when an aspiration has actually occurred ... Aspiration classifier The proposed feature combinations and radial basis classifier achieved approximately 80% adjusted accuracy in classifying aspirations and swallows This accuracy level already exceeds ... are unbalanced We thus also examine classifier performance on aspirations and swallows individually Sensitivity is the proportion of actual aspirations that are correctly classified as aspirations,...
- 17
- 497
- 0